We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us

Clontech Takara Cellartis

Close

  • ‹ Back to Other tag purification
  • Streptavidin-based enrichment using Capturem technology
  • Selection guide: peptide tags
  • Myc-tagged protein purification overview
  • GST-tagged protein purification overview
Capturem Streptavidin product page Visit the Capturem Streptavidin product page
Home › Learning centers › Protein research › Other tag purification › Streptavidin-based enrichment using Capturem technology

Protein research

  • Capturem technology
    • Capturem protocols
    • Capturem tech notes and applications
    • FAQs about Capturem technology
    • Capturem technology citations
    • Capturem posters
  • Antibody immunoprecipitation
    • IP and Co-IP of cardiac voltage-gated ion channel proteins
    • Tech note: thiophilic antibody purification resins
    • Tech note: IP and Co-IP
  • His-tag purification
    • Purification methods overview
    • TALON resin selection guide
    • Selection guide: His60 resin
    • xTractor Buffer is optimized for superior protein yield
    • Why tag a protein?
    • Tech note: cobalt resin
    • Simplified purification of active, secreted his-tagged proteins
    • Overview: His60
    • Tech note: Capturem technology
    • Tech note: Capturem large volume
    • Magnetic beads
    • FAQs: TALON
    • Protocols
      • Video: Capturem his maxiprep
      • Video: Capturem his miniprep
      • Visual protocol: Capturem his maxiprep
      • Visual protocol: Capturem his miniprep
      • Capturem nickel column reagent compatibility
      • TALON reagent compatibility
      • His60 reagent compatibility
      • TALON: Native vs denaturing purification
      • Protocol: denaturing purification with TALON resin, imidazole elution
      • Protocol: native purification with TALON resin, imidazole elution
      • Protocol: native purification with TALON resin, pH elution
  • Other tag purification
    • Streptavidin-based enrichment using Capturem technology
    • Selection guide: peptide tags
    • Myc-tagged protein purification overview
    • GST-tagged protein purification overview
  • Phosphoprotein and glycoprotein purification
    • Non-tagged protein purification overview
    • Phosphoprotein purification overview
  • Matchmaker Gold yeast two-hybrid systems
    • Matchmaker Gold Yeast Two-Hybrid System
    • Make your own library for yeast two-hybrid screening
    • Mate and Plate yeast two-hybrid cDNA libraries
    • Aureobasidin A for improved selectable drug resistance in yeast
  • Expression systems
    • Protein expression overview
    • Insect expression overview
    • Mammalian expression overview
    • pHEK293 Ultra expression overview
    • OKT3 expression in mammalian cells
    • Bacterial expression overview
New products
Need help?
Contact Sales
Capturem Streptavidin product page Visit the Capturem Streptavidin product page
Tech Note

Simple, rapid streptavidin-based enrichment using Capturem technology

  • 5- to 15-minute enrichment protocol of biotinylated compounds, including antibodies, proteins, and nucleic acids
  • Available in 96-well plates for high-throughput applications, compatible with centrifugation or vacuum and positive pressure automated systems
  • High well-to-well reproducibility ensures consistent results for your assays
Introduction Results Conclusion Methods

Introduction  

Streptavidin-based capture plays an important role in protein chemistry and antibody discovery workflows. The high affinity of streptavidin for biotin enables biotinylated moieties (proteins, peptides, antibodies, DNA, oligonucleotides, etc.) to be captured and immobilized on the Streptavidin surface. The immobilized molecule is then used to specifically capture a target protein (antibody or antigen) from complex matrices, allowing the purified target to be used for very precise downstream assays. Capturem products are built on a revolutionary high-capacity membrane technology that enables extremely fast purifications—in less than 15 minutes—without sacrificing yield or purity. Capturem Streptavidin Miniprep Columns and the Capturem Streptavidin 96-Well Plate use streptavidin-functionalized membranes to enable rapid capture of your biotinylated reagents. The loading capacities of the Capturem Streptavidin Miniprep Columns and Capturem Streptavidin 96-well Plates are similar, as shown below.

Loading capacities and times for available Capturem Streptavidin formats.
Biotin-antibody Biotin-BSA Biotin-ssDNA Free biotin Purification time
Capturem Streptavidin miniprep columns and 96-well plates 20–40 µg >15 µg 1,000–1,500 ng >4,000 pmol 15 minutes

Results  

Successive antibody capture

One major application for streptavidin-based pull-down experiments is the targeted enrichment of monoclonal antibodies (mAb) and proteins from complex mixtures. Here we demonstrate the use of Capturem Streptavidin to enrich an anti-rabbit IgG using a successive capture protocol that takes less than 15 minutes from start to finish. This is significantly faster than traditional methods that require incubation steps that can take up to 90 minutes.

Workflow for successive antibody capture.

Figure 1. Workflow for successive antibody capture.

Successive capture of an antibody using Capturem Streptavidin

Figure 2. Successive capture of antibodies in triplicate using Capturem Streptavidin. Panels A–C. First, 48 µg of biotinylated rabbit IgG in 200 µl Binding Buffer was passed through an equilibrated Capturem Streptavidin spin column, and 32.0 ± 1.4 µg (Panel B) was successfully immobilized on the membrane. Following a single wash step, a sample containing the spiked-in target antibody (~100 µg of anti-rabbit IgG from goat) in hybridoma medium with 20% mouse serum was diluted with Binding Buffer and applied to the Capturem Streptavidin column. After two successive washing steps with Binding Buffer and then PBS, the enriched target antibody was eluted from the biotinylated capture antibody in 1.0 M glycine in three steps to yield 42 ± 5 µg (Panel C) of highly pure target antibody.

Highly reproducible capture for high-throughput applications

Maintaining consistent performance is critical for many purification applications involving downstream quantitative analysis. We measured well-to-well reproducibility of Capturem Streptavidin 96-Well Plates using both biotinylated BSA and biotinylated oligos.

Highly reproducible capture in Capturem Streptavidin 96-well plates

Figure 3. Highly reproducible capture in Capturem Streptavidin 96-Well Plates. Eight technical replicates were loaded with either biotinylated oligonucleotide (Panel A) or biotinylated BSA (Panel B) and captured using centrifugation. Bound molecules were quantified by measuring the O.D. of samples before and after loading through the column. Standard protocols with these 96-well plates can be performed in under 15 minutes.

Conclusion  

Capturem Streptavidin enables rapid immobilization (or binding) of biotinylated compounds. Successive capture protocols can be performed using Capturem Streptavidin that dramatically shortens the hands-on time as compared to traditional methods, and these products are also compatible with traditional preincubation enrichment approaches. Capturem Streptavidin is available in both mini spin column and 96-well plate formats for both smaller experiments and high-throughput applications.

Methods  

Successive antibody capture

Spin columns were first equilibrated by adding 800 µl Equilibration Buffer to the column followed by centrifugation at 500g for 1 min. Next, spin columns were loaded with 200 µl of biotinylated rabbit IgG at 0.24 mg/ml, then centrifuged at 500g for 1 min at room temperature to immobilize the biotinylated antibody. The columns were then washed with 400 µl Wash Buffer. Subsequently, 200 µl of anti-rabbit IgG at a concentration of 0.50 mg/ml was loaded onto the column and spun at 500g for 1 min. Two more wash steps were performed, first with 400 µl Wash Buffer and then with 400 µl of PBS. Finally, the captured secondary Ab was eluted using three successive elutions, each consisting of 90 µl of 1.0 M glycine. Eluted Ab was quantified using A280 measurements from a Nanodrop spectrophotometer. Bound biotinylated Ab was quantified by measuring the absorbance before and after loading.

Binding capacity and reproducibility experiments

Technical replicates of either biotinylated oligo (Biotin-G/AGCTTCATTTCCCGTAAATCCCTAAAGCT), biotinylated BSA, or biotinylated IgG were loaded into different wells of a 96-well plate for the reproducibility experiments (Figure 2) or into different spin columns for the capacity tests (Table). Absorbance measurements (A260 for the oligonucleotides, A280 for BSA and IgG) were made before and after loading to determine the amount of biomolecules bound to the membranes. For protein binding experiments 100 µg biotinylated BSA was diluted in 200 µl Binding Buffer and applied to each well while for oligonucleotide binding, 3.8 µg of oligo in 200 µl Binding Buffer were used.

Related Products

Cat. # Product Size Price License Quantity Details
635734 Capturem™ Streptavidin 96-Well Plate 1 x 96-well plate USD $839.00

License Statement

ID Number  
273 This Product is protected by one or more patents from the family comprising: US9459188, US10207229 and any corresponding patents, divisionals, continuations, patent applications and foreign filings sharing priority with the same family.
347 This product is protected by U.S. Patents 9,895,665, 10,195,569 and foreign counterparts and/or additional U.S. and foreign patents pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The Capturem Streptavidin 96-Well Plate is a single-use, disposable plate for simple, rapid enrichment of target proteins and antibodies that bind biotinylated protein. The plate binds more than 15 µg of biotinylated BSA control per well. This plate is suitable for enrichment of target proteins and antibodies, including those from animal serum, cell culture lysates (e.g., mammalian or bacterial cell lysates), and cell culture supernatants of hybridoma cell lines. Each well can hold up to 1 ml of sample and requires a minimum elution volume of 50 µl.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

Antibody enrichment performed on Capturem Streptavidin mini spin columns

Antibody enrichment performed on Capturem Streptavidin mini spin columns

Successive capture of antibodies in triplicate using Capturem Streptavidin. Panels A–C. First, 48 µg of biotinylated rabbit IgG in 200 µl Binding Buffer was passed through an equilibrated Capturem Streptavidin spin column, and 32.0 ± 1.4 µg (Panel B) was successfully immobilized on the membrane. Following a single wash step, a sample containing the spiked-in target antibody (~100 µg of anti-rabbit IgG from goat) in hybridoma medium with 20% mouse serum was diluted with Binding Buffer and applied to the Capturem Streptavidin column. After two successive washing steps with Binding Buffer and then PBS, the enriched target antibody was eluted from the biotinylated capture antibody in 1.0 M glycine in three steps to yield 42 ± 5 µg (Panel C) of highly pure target antibody.

Back

Well-to-well reproducibility of Capturem Streptavidin 96-well plates

Well-to-well reproducibility of Capturem Streptavidin 96-well plates

Highly reproducible capture in Capturem Streptavidin 96-well plates. Eight technical replicates were loaded with either biotinylated oligonucleotide (Panel A) or biotinylated BSA (Panel B) and captured using centrifugation. Bound molecules were quantified by measuring the O.D. of samples before and after loading through the column. Standard protocols with these 96-well plates can be performed in under 15 minutes.

Back

Workflow schematic for purification or enrichment with Capturem Streptavidin

Workflow schematic for purification or enrichment with Capturem Streptavidin

Capturem Streptavidin 96-Well Plate workflow. Note: protocol time varies for each format. Check user manuals for specifics on protocol times.

Back

Capturem spin columns and filtration devices

Capturem spin columns and filtration devices

Available Capturem spin column and filtration device formats. Pictured from left to right: nanoprep, miniprep, 96-well, 24-well, maxiprep, and large-volume Capturem formats. Formats available vary for the different functionalized membranes. Check product pages for list of available formats.

Back

Load volumes and approximate yields for available Capturem formats by chemistry

Load volumes and approximate yields for available Capturem formats by chemistry

Load volumes and yields of Capturem purification formats.

Back

635734: Capturem Streptavidin 96-Well Plate

635734: Capturem Streptavidin 96-Well Plate
635733 Capturem™ Streptavidin Miniprep Columns 20 Columns USD $450.00

License Statement

ID Number  
273 This Product is protected by one or more patents from the family comprising: US9459188, US10207229 and any corresponding patents, divisionals, continuations, patent applications and foreign filings sharing priority with the same family.
347 This product is protected by U.S. Patents 9,895,665, 10,195,569 and foreign counterparts and/or additional U.S. and foreign patents pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

Capturem Streptavidin Miniprep Columns are single-use, disposable columns for simple, rapid enrichment of target proteins and antibodies that bind biotinylated proteins. The membranes are guaranteed to bind more than 15 μg of biotinylated BSA control per column. These miniprep columns are suitable for enrichment of target proteins and antibodies, including those from animal serum, cell culture lysates (e.g., mammalian or bacterial cell lysates), and cell culture supernatants of hybridoma cell lines. Each column can hold up to 850 µl of sample and requires a minimum elution volume of 100 µl.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

Antibody enrichment performed on Capturem Streptavidin mini spin columns

Antibody enrichment performed on Capturem Streptavidin mini spin columns

Successive capture of antibodies in triplicate using Capturem Streptavidin. Panels A–C. First, 48 µg of biotinylated rabbit IgG in 200 µl Binding Buffer was passed through an equilibrated Capturem Streptavidin spin column, and 32.0 ± 1.4 µg (Panel B) was successfully immobilized on the membrane. Following a single wash step, a sample containing the spiked-in target antibody (~100 µg of anti-rabbit IgG from goat) in hybridoma medium with 20% mouse serum was diluted with Binding Buffer and applied to the Capturem Streptavidin column. After two successive washing steps with Binding Buffer and then PBS, the enriched target antibody was eluted from the biotinylated capture antibody in 1.0 M glycine in three steps to yield 42 ± 5 µg (Panel C) of highly pure target antibody.

Back

Workflow schematic for purification or enrichment with Capturem Streptavidin

Workflow schematic for purification or enrichment with Capturem Streptavidin

Capturem Streptavidin 96-Well Plate workflow. Note: protocol time varies for each format. Check user manuals for specifics on protocol times.

Back

635733: Capturem Streptavidin Miniprep Columns

635733: Capturem Streptavidin Miniprep Columns

Back

Capturem spin columns and filtration devices

Capturem spin columns and filtration devices

Available Capturem spin column and filtration device formats. Pictured from left to right: nanoprep, miniprep, 96-well, 24-well, maxiprep, and large-volume Capturem formats. Formats available vary for the different functionalized membranes. Check product pages for list of available formats.

Back

Load volumes and approximate yields for available Capturem formats by chemistry

Load volumes and approximate yields for available Capturem formats by chemistry

Load volumes and yields of Capturem purification formats.

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

logo strip white

©2025 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Partnering & Licensing
  • Vector information
  • Vector document overview
  • Vector document finder
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial biology
  • Trekker FAQs
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • Antibodies and ELISA
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Our history
  • In the news
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • Trademarks
  • License statements
  • Quality statement
  • HQ-grade reagents
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
  • Website FAQs

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop exceptional products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
Takara Bio
  • Home
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Next-generation sequencing
  • Real-time PCR
  • Stem cell research
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Nucleic acid purification
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • New products
  • Special offers
  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • Services & Support
  • OEM
  • Instrument services
  • Gene and cell therapy manufacturing
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • Partnering & Licensing
  • Vector information
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Spatial biology
  • Real-time PCR
  • Nucleic acid purification
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Stem cell research
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial biology
  • Trekker FAQs
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • APPLICATIONS
  • Molecular diagnostics
  • mRNA and protein therapeutics
  • Pathogen detection
  • Immunotherapy research
  • Cancer research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Infectious diseases
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • In the news
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • HQ-grade reagents
  • International Contacts by Region
  • Need help?
  • Website FAQs
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us