Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelect^XT protocol. The modules marked in red are not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, and the ThruPLEX DNA-Seq Kit.

Reagents

• ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, or a ThruPLEX DNA-Seq Kit for library preparation
• Two blocking oligos (both required):
  • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
  • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
• Primers (both required):
  • Illumina P5 Primer: AATGATACGGCGACCACCGA
  • llumina P7 Primer: CAAGCAGAAGACGGCATACGA
• SureSelect^XT reagents: Refer to the "Required Reagents" section of the Agilent SureSelect^XT Protocol

Equipment

• As specified in the "Required Equipment" section of the Agilent SureSelect^XT Protocol.

ThruPLEX Library Preparation

1. Prepare ThruPLEX libraries according to the kit user manual.
2. Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

ThruPLEX library capture

1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
2. Follow the Agilent SureSelect^XT Protocol starting at the beginning of Chapter 4 and continuing to the end of Chapter 5 with the following modifications:
   • Chapter 4, Step 1. Hybridize DNA Samples to the Capture Library:
     • Depending on sample type, quality, fragment size, and thermal cycler used, ThruPLEX library preparation may not yield 750 ng as called for in the SureSelect^XT Protocol. If this is the case, use the entire volume of library for concentration.
     • In addition to the reagents included in the SureSelect Block Mix in Table 32 on page 66, add:
       • 1 µl of xGen Universal Blocking Oligo - TS HT-i5
       • 1 µl of xGen Universal Blocking Oligo - TS HT-i7

       NOTE: This results in a volume of 7.6 µl per reaction instead of 5.6 µl as stated in the SureSelect^XT Protocol.

   • Chapter 5, Step 1A. Amplify the Capture Libraries with Indexing Primers:
     Modify the Post-Capture PCR Reaction Mix (Table 38, page 71) to the following:
     
     

     Reagent	Volume per rxn
     Nuclease-free water	19.5 µl
     5x Herculase Rxn Buffer (clear cap)	10.0 µl
     Herculase II Fusion DNA Polymerase (red cap)	1.0 µl
     100 mM dNTP Mix (green cap)	0.5 µl
     10 µM Illumina P5 Primer	2.5 µl
     10 µM Illumina P7 Primer	2.5 µl
     Total	36.0 µl