We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us

Close

  • ‹ Back to DNA-seq protocols
  • Using UMIs with ThruPLEX Tag-Seq HV
  • Exome capture with Illumina Nextera Rapid Capture
  • Targeted capture with Roche NimbleGen SeqCap EZ
  • Targeted capture with IDT xGen panels
  • Targeted capture with Agilent SureSelectXT
  • Targeted capture with Agilent SureSelectXT2
  • Targeted capture with Agilent SureSelectQXT
  • Plasma preparation for ThruPLEX Plasma-Seq workflow
ThruPLEX DNA-seq product page ThruPLEX DNA-seq kit
ThruPLEX Plasma-Seq product page ThruPLEX Plasma-Seq kit
Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectQXT

Next-generation sequencing

  • Product line overview
  • Technical notes
    • DNA-seq
      • High-resolution CNV detection using PicoPLEX Gold DNA-Seq
      • Next-gen WGA method for CNV and SNV detection from single cells
      • Low-volume DNA shearing for ThruPLEX library prep
      • Low-input whole-exome sequencing
      • Cell-free nucleic acid sequencing
      • DNA-seq from FFPE samples
      • ThruPLEX HV data sheet
      • Improvements to ThruPLEX HV
      • ThruPLEX HV outperforms NEBNext Ultra II
      • Comparing ThruPLEX HV PLUS to Kapa and NEBNext
      • Low cell number ChIP-seq using ThruPLEX DNA-Seq
      • Accurate detection of low-frequency variants using molecular tags
    • Immune Profiling
      • Efficient and sensitive profiling of human B-cell receptor repertoire
      • TCRv2 kit validated for rhesus macaque samples
      • TCR repertoire profiling from mouse samples (bulk)
      • BCR repertoire profiling from mouse samples (bulk)
      • Improved TCR repertoire profiling from human samples (bulk)
      • TCR repertoire profiling from human samples (single cells)
      • BCR repertoire profiling from human samples (bulk)
    • RNA-seq
      • All-in-one cDNA synthesis and library prep from single cells
      • Automation-friendly, all-in-one cDNA synthesis and library prep
      • All-in-one cDNA synthesis and library prep from ultra-low RNA inputs
      • 3' mRNA libraries from single cells (SMART-Seq v4 3' DE Kit)
      • Full-length mRNA-seq for target capture
      • Stranded libraries from single cells
      • Stranded libraries from picogram-input total RNA (v3)
      • Stranded libraries from 100 pg-100 ng total RNA
      • Stranded libraries from 100 ng - 1 ug total RNA
      • Stranded libraries from FFPE inputs (v2)
      • Nonstranded libraries from FFPE inputs
      • Singular and Takara Bio library prep
    • Epigenetic sequencing
      • ChIP-seq libraries for transcription factor analysis
      • ChIP-seq libraries from ssDNA
      • Full-length small RNA libraries
      • Methylated DNA-seq with MBD2
    • Reproductive health technologies
      • Embgenix PGT-A (CE-IVD & RUO)
  • Featured kits
  • Technology and application overviews
    • SMART technology
    • Single-cell mRNA-seq
    • Total RNA-seq
    • Biomarker discovery with RNA-seq
    • SMART-Seq PLUS solutions
    • Whole genome amplification from single cells
    • Sequencing depth for ThruPLEX Tag-seq
  • FAQs and tips
    • RNA-seq FAQs
    • RNA-seq tips
    • Positive and negative controls in scRNA-seq
    • DNA-seq FAQs
    • ChIP-seq FAQs
    • Indexing FAQs
    • TCR-seq methods: Q&A
    • STORM-seq Q&A
    • Pushing the limits Q&A
    • Liver metabolic function Q&A
    • Neural multiomics Q&A
  • DNA-seq protocols
    • Using UMIs with ThruPLEX Tag-Seq HV
    • Exome capture with Illumina Nextera Rapid Capture
    • Targeted capture with Roche NimbleGen SeqCap EZ
    • Targeted capture with IDT xGen panels
    • Targeted capture with Agilent SureSelectXT
    • Targeted capture with Agilent SureSelectXT2
    • Targeted capture with Agilent SureSelectQXT
    • Plasma preparation for ThruPLEX Plasma-Seq workflow
  • Bioinformatics resources
    • Cogent NGS Analysis Pipeline
      • Cogent NGS Analysis Pipeline notices
    • Cogent NGS Discovery Software
      • Cogent NGS Discovery Software notices
    • Cogent NGS Immune Profiler
      • Cogent NGS Immune Profiler Software notices
      • Cogent NGS Immune Profiler Software videos
    • Cogent NGS Immune Viewer
    • Embgenix Analysis Software
    • ICELL8 scTCR Analyzer
    • SMARTer Human scTCR Demultiplexer
    • SMART-Seq DE3 Demultiplexer
  • Newsletters
    • 2021 H1 NGS newsletter
    • 2020 NGS newsletter
  • Webinars
    • Harnessing the power of full-length transcriptome analysis for biomarker discoveries
    • SMART-Seq Pro kits for biomarker detection
    • Takara Bio Single-Cell Workshop, Spring 2021
    • Capturing biological complexity by high-resolution single-cell genomics
    • Sensitivity and scale for neuron multiomics
    • Taking single-cell RNA-seq by STORM
    • Pushing the limits of sensitivity for single-cell applications
    • Liver metabolic function, dissecting one cell at a time
    • Single-Cell Workshop at 2020 NextGen Omics Series UK
    • TCR-seq methods: when to use which
    • Immunogenomics to accelerate immunotherapy
    • Total RNA sequencing of liquid biopsies
    • MeD-Seq, a novel method to detect DNA methylation
    • Automating full-length single-cell RNA-seq libraries
    • Single-cell DNA-seq
    • Single-cell whole transcriptome analysis
  • Citations
    • Epigenetics citations
    • Microbiome citations
    • PicoPLEX citations
    • SMARTer RNA-seq citations
    • ThruPLEX DNA-seq citations
    • ThruPLEX Plasma-seq citations
  • Posters
New products
Need help?
Contact Sales
ThruPLEX DNA-seq product page ThruPLEX DNA-seq kit
ThruPLEX Plasma-Seq product page ThruPLEX Plasma-Seq kit
User-generated protocol

Targeted capture of ThruPLEX libraries with Agilent SureSelectQXT

Introduction Materials required Protocol

Introduction  

Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectQXT protocol. The module marked in red is not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with all ThruPLEX DNA-Seq, ThruPLEX Plasma-Seq, and ThruPLEX Tag-seq kits.

Integration of SureSelectQXT with ThruPLEX kits
Additional reagents Primers Required Illumina P5 and P7 primers
Blocking oligos Required IDT xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase Required Agilent Cat. # 600677, 600679 (with dNTPs)
Agilent SureSelectQXT Reagent Kit SureSelectQXT Library Prep Kit, ILM, Box #2 Not used Replace with a ThruPLEX kit.
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box #1) Required The following reagent is not used: SureSelectQXT Stop Solution
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box # 2) Required The following reagent is not used: SureSelectQXT Primer Mix

Materials required  

Reagents

  • A ThruPLEX library preparation kit (choose from the ThruPLEX DNA-Seq kits, ThruPLEX Plasma-Seq kits, and ThruPLEX Tag-seq kits listed in the Related Products section at the bottom of this page)
  • Two blocking oligos (both required):
    • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
    • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
  • Primers (both required):
    • Illumina P5 Primer: AATGATACGGCGACCACCGA
    • Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
  • SureSelectQXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelectQXT protocol.

NOTE: The following item may be required for the post-capture amplification step: Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)

Equipment

  • As specified in the "Required Equipment" section of the Agilent SureSelectQXT protocol.

NOTE: When integrating ThruPLEX kits with the SureSelectQXT library capture system, all components of the SureSelectQXT Reagent Kit are used except the following:

  • SureSelectQXT Buffer
  • SureSelectQXT Enzyme Mix ILM
  • DMSO
  • SureSelectQXT Read Primer 1
  • SureSelectQXT Read Primer 2
  • SureSelectQXT Index Read Primer
  • SureSelectQXT P7 dual indexing primers
  • SureSelectQXT P5 dual indexing primers
  • SureSelectQXT Stop Solution
  • SureSelectQXT Primer Mix

Contact Agilent to order a SureSelectQXT Reagent Kit without the SureSelectQXT Library Prep Kit ILM, Box 2.

Protocol  

ThruPLEX library preparation

  1. Prepare ThruPLEX libraries according to the ThruPLEX DNA-Seq, Plasma-Seq, or Tag-seq kit user manual.
  2. Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

ThruPLEX library capture

  1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
  2. Using a narrow gauge needle, poke hole(s) in the lid of each tube containing a ThruPLEX library to be used for capture.
  3. Concentrate the ThruPLEX library using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <10 µl. Do not completely dry the mixture.
  4. Bring the volume to 10 µl with nuclease-free water.
  5. To each resuspended library add:
    • 1 µl xGen Universal Blocking Oligo - TS HT-i5
    • 1 µl xGen Universal Blocking Oligo - TS HT-i7
  6. Follow procedures in the Agilent SureSelectQXT Protocol starting at Chapter 3, Step 2 through the end of Chapter 4, Step 5 with the following modification:
    At Chapter 4, Step 1. Amplify the Captured Libraries, modify the Post-Capture PCR Reaction Mix to the following:

    Reagent Volume per rxn
    Nuclease-free water 10.5 µl
    5x Herculase Rxn Buffer 10.0 µl
    Herculase II Fusion DNA Polymerase 1.0 µl
    100 mM dNTP Mix 0.5 µl
    10 µM Illumina P5 Primer 2.5 µl
    10 µM Illumina P7 Primer 2.5 µl
    Total 27.0 µl
    The ThruPLEX libraries are already indexed, so do not use the SureSelectQXT indexing primers.

NOTE: This protocol was developed using the SureSelectXT Human All Exon v5 Capture Library.

Related Products

Cat. # Product Size License Quantity Details
R400584 ThruPLEX® Tag-seq 6S (12) Kit 12 Rxns USD $810.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550, 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 6 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 12 reactions with 6 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400584: ThruPLEX Tag-seq 6S (12) Kit

R400584: ThruPLEX Tag-seq 6S (12) Kit
R400585 ThruPLEX® Tag-seq 48S Kit 48 Rxns USD $2699.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550, 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 48 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 48 reactions with 48 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400585: SMARTer ThruPLEX Tag-seq 48S Kit

R400585: SMARTer ThruPLEX Tag-seq 48S Kit
R400586 ThruPLEX® Tag-seq 96D Kit 96 Rxns USD $4750.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550, 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 96 dual index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 96 reactions with 96 dual-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400586: ThruPLEX Tag-seq 96D Kit

R400586: ThruPLEX Tag-seq 96D Kit
R400674 ThruPLEX® DNA-Seq Kit 24 Rxns USD $705.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400674: ThruPLEX DNA-Seq Kit

R400674: ThruPLEX DNA-Seq Kit
R400675 ThruPLEX® DNA-Seq Kit 48 Rxns USD $1360.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400675: ThruPLEX DNA-Seq Kit

R400675: ThruPLEX DNA-Seq Kit
R400676 ThruPLEX® DNA-Seq Kit 96 Rxns USD $2493.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400676: ThruPLEX DNA-Seq Kit

R400676: ThruPLEX DNA-Seq Kit
R400677 ThruPLEX® DNA-Seq Kit 480 Rxns USD $11040.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. No. R400676), 480 reactions total, of ThruPLEX DNA-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400677: SMARTer ThruPLEX DNA-Seq Kit

R400677: SMARTer ThruPLEX DNA-Seq Kit
R400679 ThruPLEX® Plasma-Seq Kit 24 Rxns USD $757.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400679: ThruPLEX Plasma-Seq Kit

R400679: ThruPLEX Plasma-Seq Kit
R400680 ThruPLEX® Plasma-Seq Kit 48 Rxns USD $1432.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400680: ThruPLEX Plasma-Seq Kit

R400680: ThruPLEX Plasma-Seq Kit
R400681 ThruPLEX® Plasma-Seq Kit 96 Rxns USD $2484.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400681: ThruPLEX Plasma-Seq Kit

R400681: ThruPLEX Plasma-Seq Kit
R400682 ThruPLEX® Plasma-Seq Kit 480 Rxns USD $11639.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. # R400681), 480 reactions total, of ThruPLEX Plasma-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components


User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2022 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

©2023 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Whole genome amplification
  • Immune profiling
  • Diagnostic solutions
  • Reproductive health
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • High-throughput qPCR solutions
  • RNA extraction and analysis for real-time qPCR
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Single-cell cloning of edited hiPS cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Cell-free DNA purification kits
  • Microbiome
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • Free samples
  • TB Green qPCR sale
  • PrimeSTAR enzyme promo
  • Try BcaBEST DNA Polymerase ver.2.0
  • RNA purification sale
  • Capturem IP and Co-IP sale
  • Baculovirus titration kits early access program
  • NGS bundle and save
  • Free sample: PrimePath Direct Saliva SARS-CoV-2 Detection Kit
  • TALON his-tag purification resin special offer
  • GoStix Plus special offers
  • PCR samples
  • OEM
  • Capabilities and installations
  • OEM enzyme FAQs
  • Enzyme samples for commerical assay developers
  • OEM process
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Partnering & Licensing
  • Vector information
  • Vector document overview
  • Vector document finder
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Technical notes
  • Featured kits
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • cDNA synthesis
  • Real-time PCR
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Guest webinar: developing and validating molecular diagnostic tests
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • PCR
  • Citations
  • Selection guides
  • Technical notes
  • FAQ
  • Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • Antibodies and ELISA
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Webinar: Speeding up diagnostic development
  • Contact us
  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
  • ESM Collection Kit forms
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Our history
  • Announcements
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • Trademarks
  • License statements
  • Quality statement
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Need help?
  • Privacy request
  • Website FAQs

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop best-in-class products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
  • Home
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Next-generation sequencing
  • Diagnostic solutions
  • Real-time PCR
  • Stem cell research
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Nucleic acid purification
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • New products
  • Special offers
  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Whole genome amplification
  • Immune profiling
  • Diagnostic solutions
  • Reproductive health
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • High-throughput qPCR solutions
  • RNA extraction and analysis for real-time qPCR
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Single-cell cloning of edited hiPS cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Cell-free DNA purification kits
  • Microbiome
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • Special offers
  • Free samples
  • TB Green qPCR sale
  • PrimeSTAR enzyme promo
  • Try BcaBEST DNA Polymerase ver.2.0
  • RNA purification sale
  • Capturem IP and Co-IP sale
  • Baculovirus titration kits early access program
  • NGS bundle and save
  • Free sample: PrimePath Direct Saliva SARS-CoV-2 Detection Kit
  • TALON his-tag purification resin special offer
  • GoStix Plus special offers
  • PCR samples
  • Services & Support
  • OEM
  • Instrument services
  • Stem cell services
  • Gene and cell therapy manufacturing
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • Partnering & Licensing
  • Vector information
  • OEM
  • Capabilities and installations
  • OEM enzyme FAQs
  • Enzyme samples for commerical assay developers
  • OEM process
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • cDNA synthesis
  • Real-time PCR
  • Nucleic acid purification
  • PCR
  • Cloning
  • Stem cell research
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Technical notes
  • Featured kits
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Real-time PCR
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Guest webinar: developing and validating molecular diagnostic tests
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • PCR
  • Citations
  • Selection guides
  • Technical notes
  • FAQ
  • Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • APPLICATIONS
  • Molecular diagnostics
  • Vaccine development
  • Pathogen detection
  • Immunotherapy research
  • Cancer research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Webinar: Speeding up diagnostic development
  • Contact us
  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
  • ESM Collection Kit forms
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • Announcements
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • Takara Bio affiliates & distributors
  • Need help?
  • Website FAQs
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Need help?
  • Privacy request
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us