We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept

Our website is undergoing system upgrades from July 1 to July 5, 2022. Online ordering and order processing will be disrupted during this time. For urgent order inquiries, please email ordersUS@takarabio.com, however, orders requested during the system upgrade will not be processed until after July 5. We appreciate your patience.

Close

Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectQXT

Next-generation sequencing

New products
Need help?
Contact Sales
ThruPLEX DNA-seq product page ThruPLEX DNA-seq kit
ThruPLEX Plasma-Seq product page ThruPLEX Plasma-Seq kit
User-generated protocol

Targeted capture of ThruPLEX libraries with Agilent SureSelectQXT

Introduction  

Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectQXT protocol. The module marked in red is not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with all ThruPLEX DNA-Seq, ThruPLEX Plasma-Seq, and ThruPLEX Tag-seq kits.

Integration of SureSelectQXT with ThruPLEX kits
Additional reagents Primers Required Illumina P5 and P7 primers
Blocking oligos Required IDT xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase Required Agilent Cat. # 600677, 600679 (with dNTPs)
Agilent SureSelectQXT Reagent Kit SureSelectQXT Library Prep Kit, ILM, Box #2 Not used Replace with a ThruPLEX kit.
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box #1) Required The following reagent is not used: SureSelectQXT Stop Solution
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box # 2) Required The following reagent is not used: SureSelectQXT Primer Mix

Materials required  

Reagents

  • A ThruPLEX library preparation kit (choose from the ThruPLEX DNA-Seq kits, ThruPLEX Plasma-Seq kits, and ThruPLEX Tag-seq kits listed in the Related Products section at the bottom of this page)
  • Two blocking oligos (both required):
    • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
    • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
  • Primers (both required):
    • Illumina P5 Primer: AATGATACGGCGACCACCGA
    • Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
  • SureSelectQXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelectQXT protocol.

NOTE: The following item may be required for the post-capture amplification step: Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)

Equipment

  • As specified in the "Required Equipment" section of the Agilent SureSelectQXT protocol.

NOTE: When integrating ThruPLEX kits with the SureSelectQXT library capture system, all components of the SureSelectQXT Reagent Kit are used except the following:

  • SureSelectQXT Buffer
  • SureSelectQXT Enzyme Mix ILM
  • DMSO
  • SureSelectQXT Read Primer 1
  • SureSelectQXT Read Primer 2
  • SureSelectQXT Index Read Primer
  • SureSelectQXT P7 dual indexing primers
  • SureSelectQXT P5 dual indexing primers
  • SureSelectQXT Stop Solution
  • SureSelectQXT Primer Mix

Contact Agilent to order a SureSelectQXT Reagent Kit without the SureSelectQXT Library Prep Kit ILM, Box 2.

Protocol  

ThruPLEX library preparation

  1. Prepare ThruPLEX libraries according to the ThruPLEX DNA-Seq, Plasma-Seq, or Tag-seq kit user manual.
  2. Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

ThruPLEX library capture

  1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
  2. Using a narrow gauge needle, poke hole(s) in the lid of each tube containing a ThruPLEX library to be used for capture.
  3. Concentrate the ThruPLEX library using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <10 µl. Do not completely dry the mixture.
  4. Bring the volume to 10 µl with nuclease-free water.
  5. To each resuspended library add:
    • 1 µl xGen Universal Blocking Oligo - TS HT-i5
    • 1 µl xGen Universal Blocking Oligo - TS HT-i7
  6. Follow procedures in the Agilent SureSelectQXT Protocol starting at Chapter 3, Step 2 through the end of Chapter 4, Step 5 with the following modification:
    At Chapter 4, Step 1. Amplify the Captured Libraries, modify the Post-Capture PCR Reaction Mix to the following:

    Reagent Volume per rxn
    Nuclease-free water 10.5 µl
    5x Herculase Rxn Buffer 10.0 µl
    Herculase II Fusion DNA Polymerase 1.0 µl
    100 mM dNTP Mix 0.5 µl
    10 µM Illumina P5 Primer 2.5 µl
    10 µM Illumina P7 Primer 2.5 µl
    Total 27.0 µl
    The ThruPLEX libraries are already indexed, so do not use the SureSelectQXT indexing primers.

NOTE: This protocol was developed using the SureSelectXT Human All Exon v5 Capture Library.

Related Products

Cat. # Product Size License Quantity Details
R400584 ThruPLEX® Tag-seq 6S (12) Kit 12 Rxns USD $757.00 *

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 6 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 12 reactions with 6 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400585 ThruPLEX® Tag-seq 48S Kit 48 Rxns USD $2522.00 *

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 48 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 48 reactions with 48 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400586 ThruPLEX® Tag-seq 96D Kit 96 Rxns USD $4439.00 *

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 96 dual index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 96 reactions with 96 dual-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400674 ThruPLEX® DNA-Seq Kit 24 Rxns USD $658.00 *

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400675 ThruPLEX® DNA-Seq Kit 48 Rxns USD $1271.00 *

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400676 ThruPLEX® DNA-Seq Kit 96 Rxns USD $2329.00 *

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400677 ThruPLEX® DNA-Seq Kit 480 Rxns USD $10317.00 *

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. No. R400676), 480 reactions total, of ThruPLEX DNA-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400679 ThruPLEX® Plasma-Seq Kit 24 Rxns USD $707.00 *

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400680 ThruPLEX® Plasma-Seq Kit 48 Rxns USD $1338.00 *

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400681 ThruPLEX® Plasma-Seq Kit 96 Rxns USD $2321.00 *

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data
R400682 ThruPLEX® Plasma-Seq Kit 480 Rxns USD $10877.00 *

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. # R400681), 480 reactions total, of ThruPLEX Plasma-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components

User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2022 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

©2022 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top