We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About

Close

  • ‹ Back to DNA-seq protocols
  • Using UMIs with ThruPLEX Tag-Seq HV
  • Exome capture with Illumina Nextera Rapid Capture
  • Targeted capture with Roche NimbleGen SeqCap EZ
  • Targeted capture with IDT xGen panels
  • Targeted capture with Agilent SureSelectXT
  • Targeted capture with Agilent SureSelectXT2
  • Targeted capture with Agilent SureSelectQXT
  • Plasma preparation for ThruPLEX Plasma-Seq workflow
ThruPLEX DNA-seq product page ThruPLEX DNA-seq kit
ThruPLEX Plasma-Seq product page ThruPLEX Plasma-Seq product page (Legacy)
Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectQXT

Next-generation sequencing

  • Product line overview
  • Technical notes
    • Single-cell RNA- and DNA-seq
      • All-in-one cDNA synthesis and library prep from single cells
      • Highest sensitivity for single-cell mRNA-seq
      • Stranded libraries from single cells
      • Streamlined single-cell mRNA-seq
      • Full-length mRNA libraries from single cells (SMART-Seq v4)
      • 3' mRNA libraries from single cells (SMART-Seq v4 3' DE Kit)
      • Full-length mRNA libraries from single cells for Fluidigm C1 (SMART-Seq v4)
      • Full-length single-cell library method comparison
      • High-resolution CNV detection using PicoPLEX Gold DNA-Seq
      • Next-gen WGA method for CNV and SNV detection from single cells
    • RNA-seq
      • Stranded libraries from picogram-input total RNA (v3)
      • Automation-friendly, all-in-one cDNA synthesis and library prep
      • All-in-one cDNA synthesis and library prep from ultra-low RNA inputs
      • Stranded libraries from picogram-input total RNA (v2)
      • Stranded libraries from FFPE inputs (v2)
      • Stranded libraries from 100 ng - 1 ug total RNA
      • Stranded libraries from 100 pg-100 ng total RNA
      • Stranded libraries from picogram-input total RNA (v1)
      • Stranded RNA-seq competitor kit comparison
      • Nonstranded libraries from FFPE inputs
      • Sensitive capture of full-length transcript information with targeted RNA-seq
    • DNA-seq
      • Comparing ThruPLEX HV PLUS to Kapa and NEBNext
      • Improvements to ThruPLEX HV
      • ThruPLEX HV outperforms NEBNext Ultra II
      • Accurate detection of low-frequency variants using molecular tags
      • Streamlined DNA-seq from challenging samples
      • Low cell number ChIP-seq using SMARTer ThruPLEX
      • Cell-free DNA sequencing
      • Sequencing analysis of low-frequency mutations in cfDNA
      • DNA-seq from FFPE samples
      • Low-input whole-exome sequencing
      • Tag-seq variant detection
      • Low-volume DNA shearing for SMARTer ThruPLEX library prep
    • Immune profiling
      • BCR repertoire profiling from human samples (bulk)
      • Improved TCR repertoire profiling from human samples (bulk)
      • TCR repertoire profiling from human samples (single cells)
      • TCR repertoire profiling from human samples (bulk)
      • TCR repertoire profiling from mouse samples (bulk)
      • BCR repertoire profiling from mouse samples (bulk)
    • Epigenetics and smRNA-seq
      • Full-length small RNA libraries
      • ChIP-seq libraries for transcription factor analysis
      • ChIP-seq libraries from ssDNA
      • Methylated DNA-seq
  • Featured kits
  • Technology and application overviews
    • SMART technology
    • Single-cell mRNA-seq
    • Total RNA-seq
    • Biomarker discovery with RNA-seq
    • SMART-Seq PLUS solutions
    • Whole genome amplification from single cells
    • Cell-free nucleic acid sequencing
    • ThruPLEX HV data sheet
    • Sequencing depth for ThruPLEX Tag-seq
  • FAQs and tips
    • RNA-seq FAQs
    • RNA-seq tips
    • Positive and negative controls in scRNA-seq
    • DNA-seq FAQs
    • ChIP-seq FAQs
    • Indexing FAQs
  • DNA-seq protocols
    • Using UMIs with ThruPLEX Tag-Seq HV
    • Exome capture with Illumina Nextera Rapid Capture
    • Targeted capture with Roche NimbleGen SeqCap EZ
    • Targeted capture with IDT xGen panels
    • Targeted capture with Agilent SureSelectXT
    • Targeted capture with Agilent SureSelectXT2
    • Targeted capture with Agilent SureSelectQXT
    • Plasma preparation for ThruPLEX Plasma-Seq workflow
  • Bioinformatics resources
    • Cogent NGS Immune Profiler Software
      • Cogent NGS Immune Profiler Software notices
      • Cogent NGS Immune Profiler Software videos
    • ICELL8 scTCR Analyzer
    • SMARTer Human scTCR Demultiplexer
    • Cogent NGS Analysis Pipeline
      • Cogent NGS Analysis Pipeline v1.0 User Manual
      • Cogent NGS Analysis Pipeline notices
    • Cogent NGS Discovery Software
      • Cogent NGS Discovery Software v1.0 User Manual
      • Cogent NGS Discovery Software notices
    • SMART-Seq DE3 Demultiplexer
  • Newsletters
    • 2020 NGS newsletter
  • Webinars
    • Single-Cell Workshop
    • TCR-seq methods: when to use which
    • Taking single-cell RNA-seq by STORM
    • Immunogenomics to accelerate immunotherapy
    • Total RNA sequencing of liquid biopsies
    • MeD-Seq, a novel method to detect DNA methylation
    • Automating full-length single-cell RNA-seq libraries
    • Single-cell DNA-seq
    • Single-cell whole transcriptome analysis
  • Citations
    • Epigenetics citations
    • Microbiome citations
    • PicoPLEX citations
    • SMARTer RNA-seq citations
    • ThruPLEX DNA-seq citations
    • ThruPLEX Plasma-seq citations
  • Posters
New products
Need help?
Contact Sales
ThruPLEX DNA-seq product page ThruPLEX DNA-seq kit
ThruPLEX Plasma-Seq product page ThruPLEX Plasma-Seq product page (Legacy)
User-generated protocol

Targeted capture of ThruPLEX libraries with Agilent SureSelectQXT

Introduction Materials required Protocol

Introduction  

Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectQXT protocol. The module marked in red is not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with all ThruPLEX DNA-Seq, ThruPLEX Plasma-Seq, and ThruPLEX Tag-seq kits.

Integration of SureSelectQXT with ThruPLEX kits
Additional reagents Primers Required Illumina P5 and P7 primers
Blocking oligos Required IDT xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase Required Agilent Cat. # 600677, 600679 (with dNTPs)
SureSelectQXT Library Prep Kit, ILM, Box #2 Not used Replace with a ThruPLEX kit.
Agilent SureSelectQXT Reagent Kit SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box #1) Required The following reagent is not used: SureSelectQXT Stop Solution
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box # 2) Required The following reagent is not used: SureSelectQXT Primer Mix

Materials required  

Reagents

  • A ThruPLEX library preparation kit (choose from the ThruPLEX DNA-Seq kits, ThruPLEX Plasma-Seq kits, and ThruPLEX Tag-seq kits listed in the Related Products section at the bottom of this page)
  • Two blocking oligos (both required):
    • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
    • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
  • Primers (both required):
    • Illumina P5 Primer: AATGATACGGCGACCACCGA
    • Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
  • SureSelectQXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelectQXT protocol.

NOTE: The following item may be required for the post-capture amplification step: Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)

Equipment

  • As specified in the "Required Equipment" section of the Agilent SureSelectQXT protocol.

NOTE: When integrating ThruPLEX kits with the SureSelectQXT library capture system, all components of the SureSelectQXT Reagent Kit are used except the following:

  • SureSelectQXT Buffer
  • SureSelectQXT Enzyme Mix ILM
  • DMSO
  • SureSelectQXT Read Primer 1
  • SureSelectQXT Read Primer 2
  • SureSelectQXT Index Read Primer
  • SureSelectQXT P7 dual indexing primers
  • SureSelectQXT P5 dual indexing primers
  • SureSelectQXT Stop Solution
  • SureSelectQXT Primer Mix

Contact Agilent to order a SureSelectQXT Reagent Kit without the SureSelectQXT Library Prep Kit ILM, Box 2.

Protocol  

ThruPLEX library preparation

  1. Prepare ThruPLEX libraries according to the ThruPLEX DNA-Seq, Plasma-Seq, or Tag-seq kit user manual.
  2. Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

ThruPLEX library capture

  1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
  2. Using a narrow gauge needle, poke hole(s) in the lid of each tube containing a ThruPLEX library to be used for capture.
  3. Concentrate the ThruPLEX library using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <10 µl. Do not completely dry the mixture.
  4. Bring the volume to 10 µl with nuclease-free water.
  5. To each resuspended library add:
    • 1 µl xGen Universal Blocking Oligo - TS HT-i5
    • 1 µl xGen Universal Blocking Oligo - TS HT-i7
  6. Follow procedures in the Agilent SureSelectQXT Protocol starting at Chapter 3, Step 2 through the end of Chapter 4, Step 5 with the following modification:
    At Chapter 4, Step 1. Amplify the Captured Libraries, modify the Post-Capture PCR Reaction Mix to the following:

    Reagent Volume per rxn
    Nuclease-free water 10.5 µl
    5x Herculase Rxn Buffer 10.0 µl
    Herculase II Fusion DNA Polymerase 1.0 µl
    100 mM dNTP Mix 0.5 µl
    10 µM Illumina P5 Primer 2.5 µl
    10 µM Illumina P7 Primer 2.5 µl
    Total 27.0 µl
    The ThruPLEX libraries are already indexed, so do not use the SureSelectQXT indexing primers.

NOTE: This protocol was developed using the SureSelectXT Human All Exon v5 Capture Library.

Related Products

Cat. # Product Size Price License Quantity Details
R400674 ThruPLEX® DNA-Seq Kit 24 Rxns USD $645.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400674: ThruPLEX DNA-Seq Kit

R400674: ThruPLEX DNA-Seq Kit
R400675 ThruPLEX® DNA-Seq Kit 48 Rxns USD $1246.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400675: ThruPLEX DNA-Seq Kit

R400675: ThruPLEX DNA-Seq Kit
R400676 ThruPLEX® DNA-Seq Kit 96 Rxns USD $2283.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400676: ThruPLEX DNA-Seq Kit

R400676: ThruPLEX DNA-Seq Kit
R400677 ThruPLEX® DNA-Seq Kit 480 Rxns USD $10114.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. No. R400676), 480 reactions total, of ThruPLEX DNA-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400679 ThruPLEX® Plasma-Seq Kit 24 Rxns USD $693.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400679: ThruPLEX Plasma-Seq Kit

R400679: ThruPLEX Plasma-Seq Kit
R400680 ThruPLEX® Plasma-Seq Kit 48 Rxns USD $1311.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400680: ThruPLEX Plasma-Seq Kit

R400680: ThruPLEX Plasma-Seq Kit
R400681 ThruPLEX® Plasma-Seq Kit 96 Rxns USD $2275.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400681: ThruPLEX Plasma-Seq Kit

R400681: ThruPLEX Plasma-Seq Kit
R400682 ThruPLEX® Plasma-Seq Kit 480 Rxns USD $10877.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. # R400681), 480 reactions total, of ThruPLEX Plasma-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400585 ThruPLEX® Tag-seq 48S Kit 48 Rxns USD $2472.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550; 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 48 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 48 reactions with 48 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400585: SMARTer ThruPLEX Tag-seq 48S Kit

R400585: SMARTer ThruPLEX Tag-seq 48S Kit
R400584 ThruPLEX® Tag-seq 6S (12) Kit 12 Rxns USD $742.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550; 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 6 unique single index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 12 reactions with 6 single-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400584: ThruPLEX Tag-seq 6S (12) Kit

R400584: ThruPLEX Tag-seq 6S (12) Kit
R400586 ThruPLEX® Tag-seq 96D Kit 96 Rxns USD $4351.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
384 This product is protected by U.S. Patents 7,803,550; 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX Tag-seq Kit includes all necessary reagents for generating and multiplexing DNA-seq libraries with the incorporation of Unique Molecular Indexes (UMIs), and includes 96 dual index PCR primer sets. Once purified and quantified, the resulting library is ready for Illumina NGS instruments using standard Illumina sequencing reagents and protocols. Only 50 pg to 50 ng of fragmented double-stranded DNA is required for library preparation. The entire three-step workflow takes place in a single tube or well in about two hours. No intermediate purification steps or sample transfers are necessary, preventing handling errors and loss of valuable samples. This kit includes reagents sufficient for 96 reactions with 96 dual-index primer sets.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400586: ThruPLEX Tag-seq 96D Kit

R400586: ThruPLEX Tag-seq 96D Kit


User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2020 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, TBUSA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
  • Corporate development
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

©2021 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Drug discovery
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Immune profiling
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Publications
  • Automation systems
  • SmartChip Real-Time PCR System, chips, and reagents
  • Apollo system
  • ICELL8 system and software
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Whole genome amplification
  • Immune profiling
  • Bioinformatics tools
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • RNA extraction and analysis for real-time qPCR
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Human iPS cell gene editing systems
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • cDNA synthesis
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion Cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Cell biology assays
  • Extracellular vesicle isolation
  • Exosome isolation (cell culture)
  • Reporter systems
  • Apoptosis detection kits
  • Epigenetics
  • Signal transduction
  • Gene function
  • Gene editing
  • Fluorescent proteins
  • Viral transduction
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • GoStix Plus special offers
  • PCR samples
Vaccine development

Vaccine development

The rapid spread of severe infections by viruses such as SARS-CoV-2, HIV, H1N1, Ebola, and Zika has highlighted the critical need for the rapid development of vaccines against previously unknown pathogens to deal with pandemics such as COVID-19 effectively.

Takara Bio is proud to be on the front line in the fight to defeat the novel coronavirus by enabling innovative vaccine development. This section discusses tools and techniques to overcome the challenges faced during the vaccine development process.

Learn how our products help speed up vaccine development

  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • Apollo library prep system introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Product line overview
  • Technical notes
  • FAQs and tips
  • Bioinformatics resources
  • Newsletters
  • Webinars
  • Citations
  • Posters
  • Real-time PCR
  • Product finder
  • Reaction size guidelines for qPCR
  • Real-time PCR products brochure
  • Real-time PCR tutorial videos
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Overview
  • Technical notes
  • FAQs
  • Stem cell research
  • Protocols
  • Applications
  • Technical notes
  • Webinars
  • Videos
  • Citations
  • Nucleic acid purification
  • Product finder
  • Plasmid purification
  • Genomic DNA purification
  • DNA/RNA cleanup and extraction
  • Automated DNA and RNA purification
  • RNA purification
  • Hard-to-lyse samples
  • cDNA synthesis
  • PCR
  • Citations
  • Selection guides
  • PCR enzyme brochure
  • Technical notes
  • PCR FAQs
  • Cloning
  • In-Fusion Cloning: general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and tech notes
  • Cell biology assays
  • Extracellular vesicle isolation
  • Technical notes
  • FAQs
  • Citations
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Transfection reagents
  • Fluorescent proteins
  • Protein research
  • Capturem technology
  • Antibody purification
  • His-tag purification
  • Phosphoprotein and glycoprotein purification
  • Mass spectrometry digestion reagents
  • Matchmaker Gold yeast two-hybrid systems
  • Antibodies and ELISA
Capturem Trypsin for a rapid, efficient mass spectometry workflow at room temperature.

Speed up your mass spec workflow

Capturem Trypsin provides rapid, efficient, and complete digestion of protein samples, allowing an uninterrupted mass spectometry workflow at room temperature for downstream protein analysis. This product utilizes our novel Capturem technology in a spin column format with membrane-immobilized trypsin. Capturem Trypsin Columns may be used to completely digest protein samples in less than a minute with digestion efficiencies (protein coverage) comparable to or better than those obtained using in-solution trypsin digestion.

Capturem trypsin technology

  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • OEM & custom enzyme manufacturing
  • Services
  • Quality
  • Expertise
  • OEM enzyme FAQs
  • Custom enzyme samples
  • Exploring OEM and custom enzyme partnerships
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Corporate development
  • Partnering & OEM solutions
  • In licensing
  • Out licensing
  • Submit a licensing request
  • Webinars
  • NGS: biomarkers and oncology
  • NGS: immunology
  • Stem cells
  • Real-time PCR
  • Gene function
  • Protein science
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

Learn more

  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Our history
  • Announcements
  • Events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Trademarks
  • License statements
  • Quality statement
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Need help?
  • Website FAQs
Best-in-class products, expert support, superior value

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop best-in-class products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
  • Home
  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, TBUSA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Automation systems
  • Next-generation sequencing
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
  • Antibodies and ELISA
  • Cell biology assays
  • Real-time PCR
  • cDNA synthesis
  • COVID-19 research
  • Drug discovery
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Immune profiling
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Publications
  • Automation systems
  • SmartChip Real-Time PCR System, chips, and reagents
  • Apollo system
  • ICELL8 system and software
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Whole genome amplification
  • Immune profiling
  • Epigenetics and small RNA sequencing
  • NGS accessories
  • Bioinformatics tools
  • Gene function
  • Gene editing
  • Fluorescent proteins
  • Viral transduction
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • ProteoTuner protein control systems
  • iDimerize inducible protein interaction systems
  • Transfection reagents
  • Mammalian expression plasmids
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Human iPS cell gene editing systems
  • Accessories
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Expression vectors & systems
  • Glycobiology
  • Antibodies and immunoprecipitation
  • SDS-PAGE & western blotting
  • Protein sequencing
  • Accessory enzymes
  • PCR
  • Most popular polymerases
  • Standard PCR
  • High-yield PCR
  • High-fidelity PCR
  • Fast PCR
  • Long-range PCR
  • GC rich PCR
  • Direct PCR
  • PCR master mixes
  • Custom business friendly and automation-ready solutions
  • Molecular diagnostic products
  • GMP-grade products
  • Application-specific PCR
  • Other PCR-related products
  • PCR thermal cyclers
  • Cloning
  • In-Fusion Cloning
  • Competent cells
  • Ligation kits
  • Mutagenesis kits
  • Ligation enzymes
  • Restriction enzymes
  • Modifying enzymes
  • X-Gal and IPTG
  • Linkers, primers, and cloning vectors
  • Agarose gel electrophoresis
  • Nucleic acid extraction
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • RNA cleanup kits
  • Viral DNA and RNA purification kits
  • Accessories and components
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Secondary antibodies
  • Antibody and ELISA accessories
  • Fluorescent protein antibodies
  • Cell biology assays
  • Extracellular vesicle isolation
  • Exosome isolation (cell culture)
  • Reporter systems
  • Apoptosis detection kits
  • Epigenetics
  • Cell biology reagents
  • RNA interference
  • Cell-culture accessories
  • Signal transduction
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • Real-time PCR primer sets
  • References and standards for qPCR
  • RNA extraction and analysis for real-time qPCR
  • Application-specific qPCR
  • cDNA synthesis
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • cDNA synthesis accessories
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
  • Antibodies and ELISA
  • Cell biology assays
  • Real-time PCR
  • cDNA synthesis
  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • Apollo library prep system introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Product line overview
  • Technical notes
  • Featured kits
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Newsletters
  • Webinars
  • Citations
  • Posters
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Transfection reagents
  • Fluorescent proteins
  • Stem cell research
  • Protocols
  • Applications
  • Technical notes
  • Posters
  • Webinars
  • Videos
  • FAQs
  • Citations
  • Selection guides
  • Overview
  • Protein research
  • Capturem technology
  • Antibody purification
  • His-tag purification
  • Other tag purification
  • Phosphoprotein and glycoprotein purification
  • Mass spectrometry digestion reagents
  • Matchmaker Gold yeast two-hybrid systems
  • Expression systems
  • PCR
  • Citations
  • Selection guides
  • PCR enzyme brochure
  • Technical notes
  • PCR FAQs
  • Go green with lyophilized enzymes
  • LA PCR technology
  • Cloning
  • In-Fusion Cloning: general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and tech notes
  • Sign up to stay updated
  • Traditional molecular cloning
  • Nucleic acid purification
  • Product finder
  • Plasmid purification
  • Genomic DNA purification
  • DNA/RNA cleanup and extraction
  • Parallel DNA, RNA & protein
  • Automated DNA and RNA purification
  • RNA purification
  • Hard-to-lyse samples
  • Antibodies and ELISA
  • Osteocalcin focus
  • Cell biology assays
  • Extracellular vesicle isolation
  • Technical notes
  • FAQs
  • Citations
  • Real-time PCR
  • Product finder
  • Reaction size guidelines for qPCR
  • Real-time PCR products brochure
  • Real-time PCR tutorial videos
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Overview
  • Technical notes
  • FAQs
  • cDNA synthesis
  • Premium total and poly A+ RNA
  • SMARTer RACE 5'/3' Kit—advances in SMARTer PCR cDNA synthesis
  • Cloning antibody variable regions
  • Services & Support
  • Instrument services
  • OEM & custom enzyme manufacturing
  • Stem cell services
  • Gene and cell therapy manufacturing services
  • Customer service
  • Technical support
  • Sales
  • Shipping & delivery
  • Feedback
  • Corporate development
  • Webinars from Takara Bio
  • Vector information
  • Online tools
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • OEM & custom enzyme manufacturing
  • Services
  • Quality
  • Expertise
  • OEM enzyme FAQs
  • Custom enzyme samples
  • Exploring OEM and custom enzyme partnerships
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Corporate development
  • Partnering & OEM solutions
  • In licensing
  • Out licensing
  • Submit a licensing request
  • Webinars from Takara Bio
  • NGS: biomarkers and oncology
  • NGS: immunology
  • Stem cells
  • Real-time PCR
  • Gene function
  • Protein science
  • Vector information
  • Vector document overview
  • Vector document finder
  • Online tools
  • GoStix Plus FAQs
  • Areas of interest
  • Pathogen detection
  • Vaccine development
  • Cancer research
  • Immunotherapy research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • Announcements
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • Takara Bio affiliates & distributors
  • Need help?
  • Website FAQs
  • DSS Takara Bio India Pvt. Ltd : Manufacturing
  • Our partners
  • Special offers
  • New products
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Events
  • Calendar
  • Conferences
  • Speak with us
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Special offers
  • RT-qPCR bundle promotion
  • GoStix Plus special offers
  • PCR samples
  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About