We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept

Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectQXT

Next-generation sequencing

New products
Need help?
Contact Sales
SMARTer ThruPLEX DNA-Seq product page SMARTer ThruPLEX DNA-seq kit
SMARTer ThruPLEX Plasma-Seq product page SMARTer ThruPLEX plasma-seq kit
DNA-seq application protocol

Targeted capture of SMARTer ThruPLEX libraries with Agilent SureSelectQXT

Introduction  

Enrichment of SMARTer ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectQXT protocol. The module marked in red is not required when integrating with SMARTer ThruPLEX kits. This target enrichment protocol is compatible with all SMARTer ThruPLEX DNA-Seq, SMARTer ThruPLEX Plasma-Seq, and SMARTer ThruPLEX Tag-seq kits.

Integration of SureSelectQXT with SMARTer ThruPLEX kits
Additional reagents Primers Required Illumina P5 and P7 primers
Blocking oligos Required IDT xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase Required Agilent Cat. # 600677, 600679 (with dNTPs)
SureSelectQXT Library Prep Kit, ILM, Box #2 Not used Replace with a SMARTer ThruPLEX kit.
Agilent SureSelectQXT Reagent Kit SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box #1) Required The following reagent is not used: SureSelectQXT Stop Solution
SureSelectQXT Target Enrichment Kit, ILM (Hyb module, Box # 2) Required The following reagent is not used: SureSelectQXT Primer Mix

Materials required  

Reagents

  • A SMARTer ThruPLEX library preparation kit (choose from the SMARTer ThruPLEX DNA-Seq kits, SMARTer ThruPLEX Plasma-Seq kits, and SMARTer ThruPLEX Tag-seq kits listed in the Related Products section at the bottom of this page)
  • Two blocking oligos (both required):
    • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
    • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
  • Primers (both required):
    • Illumina P5 Primer: AATGATACGGCGACCACCGA
    • Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
  • SureSelectQXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelectQXT protocol.

NOTE: The following item may be required for the post-capture amplification step: Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)

Equipment

  • As specified in the "Required Equipment" section of the Agilent SureSelectQXT protocol.

NOTE: When integrating SMARTer ThruPLEX kits with the SureSelectQXT library capture system, all components of the SureSelectQXT Reagent Kit are used except the following:

  • SureSelectQXT Buffer
  • SureSelectQXT Enzyme Mix ILM
  • DMSO
  • SureSelectQXT Read Primer 1
  • SureSelectQXT Read Primer 2
  • SureSelectQXT Index Read Primer
  • SureSelectQXT P7 dual indexing primers
  • SureSelectQXT P5 dual indexing primers
  • SureSelectQXT Stop Solution
  • SureSelectQXT Primer Mix

Contact Agilent to order a SureSelectQXT Reagent Kit without the SureSelectQXT Library Prep Kit ILM, Box 2.

Protocol  

SMARTer ThruPLEX library preparation

  1. Prepare SMARTer ThruPLEX libraries according to the SMARTer ThruPLEX DNA-Seq, Plasma-Seq, or Tag-seq kit user manual.
  2. Perform library purification using AMPure XP beads as described in the appropriate SMARTer ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

SMARTer ThruPLEX library capture

  1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
  2. Using a narrow gauge needle, poke hole(s) in the lid of each tube containing a SMARTer ThruPLEX library to be used for capture.
  3. Concentrate the SMARTer ThruPLEX library using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <10 µl. Do not completely dry the mixture.
  4. Bring the volume to 10 µl with nuclease-free water.
  5. To each resuspended library add:
    • 1 µl xGen Universal Blocking Oligo - TS HT-i5
    • 1 µl xGen Universal Blocking Oligo - TS HT-i7
  6. Follow procedures in the Agilent SureSelectQXT Protocol starting at Chapter 3, Step 2 through the end of Chapter 4, Step 5 with the following modification:
    At Chapter 4, Step 1. Amplify the Captured Libraries, modify the Post-Capture PCR Reaction Mix to the following:

    Reagent Volume per rxn
    Nuclease-free water 10.5 µl
    5x Herculase Rxn Buffer 10.0 µl
    Herculase II Fusion DNA Polymerase 1.0 µl
    100 mM dNTP Mix 0.5 µl
    10 µM Illumina P5 Primer 2.5 µl
    10 µM Illumina P7 Primer 2.5 µl
    Total 27.0 µl
    The SMARTer ThruPLEX libraries are already indexed, so do not use the SureSelectQXT indexing primers.

NOTE: This protocol was developed using the SureSelectXT Human All Exon v5 Capture Library.

Related Products

Cat. # Product Size Price License Quantity Details
R400674 SMARTer® ThruPLEX® DNA-Seq Kit 24 Rxns $597.00 *

The SMARTer ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400675 SMARTer® ThruPLEX® DNA-Seq Kit 48 Rxns $1152.00 *

The SMARTer ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400676 SMARTer® ThruPLEX® DNA-Seq Kit 96 Rxns $2112.00 *

The SMARTer ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400677 SMARTer® ThruPLEX® DNA-Seq Kit 480 Rxns $9360.00 *

The SMARTer ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. No. R400676), 480 reactions total, of SMARTer ThruPLEX DNA-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400679 SMARTer® ThruPLEX® Plasma-Seq Kit 24 Rxns $672.00 *

The SMARTer ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400680 SMARTer® ThruPLEX® Plasma-Seq Kit 48 Rxns $1272.00 *

The SMARTer ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400681 SMARTer® ThruPLEX® Plasma-Seq Kit 96 Rxns $2208.00 *

The SMARTer ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400682 SMARTer® ThruPLEX® Plasma-Seq Kit 480 Rxns $10560.00 *

The SMARTer ThruPLEX Plasma-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from cell-free DNA isolated from plasma. Single index, dual index, and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. # R400681), 480 reactions total, of SMARTer ThruPLEX Plasma-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400585 SMARTer® ThruPLEX® Tag-seq 48S Kit 48 Rxns $2400.00 *

ThruPLEX® Tag-seq 48S Kit

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400584 SMARTer® ThruPLEX® Tag-seq 6S (12) Kit 12 Rxns $720.00 *

ThruPLEX® Tag-seq 6S (12) Kit

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components
R400586 SMARTer® ThruPLEX® Tag-seq 96D Kit 96 Rxns $4224.00 *

ThruPLEX® Tag-seq 96D Kit

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components

*You must be logged in to a Business Account in order to purchase these products online, since the purchase of these products may be restricted depending on your account type. Researchers at not-for-profit accounts receive a limited use license with their purchase of the product. Researchers at for-profit accounts must obtain a license prior to purchase. For details please contact licensing@takarabio.com.

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2019 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

©2019 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top