We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us

Clontech Takara Cellartis

Close

  • ‹ Back to DNA-seq protocols
  • Using UMIs with ThruPLEX Tag-Seq FLEX
  • Targeted capture with Agilent SureSelectQXT
  • Exome capture with Illumina Nextera Rapid Capture
  • Targeted capture with Roche NimbleGen SeqCap EZ
  • Targeted capture with IDT xGen panels
  • Targeted capture with Agilent SureSelectXT
  • Targeted capture with Agilent SureSelectXT2
ThruPLEX DNA-seq product page ThruPLEX DNA-Seq Kit
ThruPLEX Plasma-Seq product page ThruPLEX FLEX
Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectXT

Next-generation sequencing

  • Product line overview
  • RNA-seq
    • Automated library prep
    • Technologies and applications
      • SMART technology
      • Single-cell mRNA-seq
      • Total RNA-seq
      • SMART-Seq PLUS solutions
    • Technotes
      • Enabling long-read RNA sequencing from low-input samples
      • Singular for low input total RNA seq
      • All-in-one cDNA synthesis and library prep from single cells
      • Automation-friendly, all-in-one cDNA synthesis and library prep
      • All-in-one cDNA synthesis and library prep from ultra-low RNA inputs
      • 3' mRNA libraries from single cells (SMART-Seq v4 3' DE Kit)
      • Full-length mRNA-seq for target capture
      • Stranded libraries from single cells
      • Stranded libraries from picogram-input total RNA (v3)
      • Stranded libraries from 100 pg-100 ng total RNA
      • Stranded libraries from 100 ng - 1 ug total RNA
      • Stranded libraries from FFPE inputs (v2)
      • Nonstranded libraries from FFPE inputs
      • Singular and Takara Bio library prep
      • Full-length, single-cell, and ultra-low-input RNA-seq with UMIs
    • Webinars
      • Pushing the limits of sensitivity for single-cell applications
      • Capturing biological complexity by high-resolution single-cell genomics
      • Taking single-cell RNA-seq by STORM
      • STORM-seq Q&A
      • Neural multiomics Q&A
      • Liver metabolic function, dissecting one cell at a time
      • Pushing the limits Q&A
      • Total RNA sequencing of liquid biopsies
      • Liver metabolic function Q&A
      • Automating full-length single-cell RNA-seq libraries
      • Single-cell whole transcriptome analysis
      • Sensitivity and scale for neuron multiomics
    • RNA-seq tips
    • RNA-seq FAQs
  • Technical notes
    • DNA-seq
      • Next-gen WGA method for CNV and SNV detection from single cells
      • Low-input whole-exome sequencing
      • DNA-seq from FFPE samples
      • Low cell number ChIP-seq using ThruPLEX DNA-Seq
      • Detection of low-frequency variants using ThruPLEX Tag-Seq FLEX
      • ThruPLEX FLEX outperforms NEBNext Ultra II
      • Streamlined DNA-seq from challenging samples
      • High-resolution CNV detection using PicoPLEX Gold DNA-Seq
      • ThruPLEX FLEX data sheet
      • Low-volume DNA shearing for ThruPLEX library prep
      • NGS library prep with enzymatic fragmentation
      • Comparing ThruPLEX FLEX EF to Kapa and NEBNext
    • Immune Profiling
      • Get started with BCR/TCR profiling
      • Track B-cell changes in your mouse model
      • Efficient and sensitive profiling of human B-cell receptor repertoire
      • TCRv2 kit validated for rhesus macaque samples
      • Improved TCR repertoire profiling from mouse samples (bulk)
      • TCR repertoire profiling from mouse samples (bulk)
      • BCR repertoire profiling from mouse samples (bulk)
      • Improved TCR repertoire profiling from human samples (bulk)
      • TCR repertoire profiling from human samples (single cells)
      • BCR repertoire profiling from human samples (bulk)
    • Epigenetic sequencing
      • ChIP-seq libraries for transcription factor analysis
      • ChIP-seq libraries from ssDNA
      • Full-length small RNA libraries
      • Methylated DNA-seq with MBD2
    • Reproductive health technologies
      • Embgenix GT-omics for TE biopsies
      • Embgenix ESM Screen
      • Embgenix PGT-A
  • Technology and application overviews
    • Embgenix GT-omics Oncology Tech Note
    • Sequencing depth for ThruPLEX Tag-seq
    • Whole genome amplification from single cells
  • FAQs and tips
    • Positive and negative controls in scRNA-seq
    • DNA-seq FAQs
    • ChIP-seq FAQs
    • Indexing FAQs
    • TCR-seq methods: Q&A
  • DNA-seq protocols
    • Using UMIs with ThruPLEX Tag-Seq FLEX
    • Targeted capture with Agilent SureSelectQXT
    • Exome capture with Illumina Nextera Rapid Capture
    • Targeted capture with Roche NimbleGen SeqCap EZ
    • Targeted capture with IDT xGen panels
    • Targeted capture with Agilent SureSelectXT
    • Targeted capture with Agilent SureSelectXT2
  • Bioinformatics resources
    • Cogent NGS Analysis Pipeline
      • Cogent NGS Analysis Pipeline notices
    • Cogent NGS Discovery Software
      • Cogent NGS Discovery Software notices
    • Cogent NGS Immune Profiler
      • Cogent NGS Immune Profiler Software notices
    • Cogent NGS Immune Viewer
    • Embgenix Analysis Software
    • SMART-Seq DE3 Demultiplexer
  • Webinars
    • Harnessing the power of full-length transcriptome analysis for biomarker discoveries
    • SMART-Seq Pro kits for biomarker detection
    • Takara Bio Single-Cell Workshop, Spring 2021
    • Single-Cell Workshop at 2020 NextGen Omics Series UK
    • Immunogenomics to accelerate immunotherapy
    • MeD-Seq, a novel method to detect DNA methylation
    • Single-cell DNA-seq
  • Posters
    • Long-read mRNA-seq poster
New products
Need help?
Contact Sales
ThruPLEX DNA-seq product page ThruPLEX DNA-Seq Kit
ThruPLEX Plasma-Seq product page ThruPLEX FLEX
User-generated protocol

Target capture of ThruPLEX libraries with Agilent SureSelectXT

Introduction Materials required Protocol

Introduction  

Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectXT protocol. The modules marked in red are not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, and the ThruPLEX DNA-Seq Kit.

Integration of SureSelectXT with ThruPLEX kits
Additional reagents Primers Required Illumina P5 and P7 primers
Blocking oligos Requred xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase Required
Agilent SureSelectXT Reagent Kit SureSelectXT Library Prep Kit ILM Not used

Replace with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq or the ThruPLEX DNA-Seq Kit.

Contact Agilent to purchase a Reagent Kit without this component.

SureSelect Target Enrichment Box #1 Required

The following components are not used:

  • SureSelect Elution Buffer
  • SureSelect Neutralization Buffer
SureSelect Target Enrichment Kit ILM Indexing Hyb Module Box #2 Required The following components are not used:

  • SureSelect ILM Indexing Pre Capture Reverse PCR Primer
  • SureSelect ILM Indexing Post Capture Forward PCR Primer

Materials required  

Reagents

  • ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, or a ThruPLEX DNA-Seq Kit for library preparation
  • Two blocking oligos (both required):
    • xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
    • xGen Universal Blocking Oligo - TS HT-i7 (IDT)
  • Primers (both required):
    • Illumina P5 Primer: AATGATACGGCGACCACCGA
    • llumina P7 Primer: CAAGCAGAAGACGGCATACGA
  • SureSelectXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelectXT Protocol

Equipment

  • As specified in the "Required Equipment" section of the Agilent SureSelectXT Protocol.

NOTE: When integrating ThruPLEX kits with the SureSelectXT library capture system, all components of the SureSelectXT Reagent Kit are used except the following:

  • SureSelectXT Library Prep Kit ILM*
  • SureSelect ILM Indexing Pre Capture Reverse PCR Primer
  • SureSelect ILM Indexing Post Capture Forward PCR Primer
*Contact Agilent to order a SureSelectXT Reagent Kit without the SureSelectXT Library Prep Kit ILM.

Protocol  

ThruPLEX Library Preparation

  1. Prepare ThruPLEX libraries according to the kit user manual.
  2. Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

ThruPLEX library capture

  1. Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
  2. Follow the Agilent SureSelectXT Protocol starting at the beginning of Chapter 4 and continuing to the end of Chapter 5 with the following modifications:
    • Chapter 4, Step 1. Hybridize DNA Samples to the Capture Library:
      • Depending on sample type, quality, fragment size, and thermal cycler used, ThruPLEX library preparation may not yield 750 ng as called for in the SureSelectXT Protocol. If this is the case, use the entire volume of library for concentration.
      • In addition to the reagents included in the SureSelect Block Mix in Table 32 on page 66, add:
        • 1 µl of xGen Universal Blocking Oligo - TS HT-i5
        • 1 µl of xGen Universal Blocking Oligo - TS HT-i7

        NOTE: This results in a volume of 7.6 µl per reaction instead of 5.6 µl as stated in the SureSelectXT Protocol.

    • Chapter 5, Step 1A. Amplify the Capture Libraries with Indexing Primers:
      Modify the Post-Capture PCR Reaction Mix (Table 38, page 71) to the following:

      Reagent Volume per rxn
      Nuclease-free water 19.5 µl
      5x Herculase Rxn Buffer (clear cap) 10.0 µl
      Herculase II Fusion DNA Polymerase (red cap) 1.0 µl
      100 mM dNTP Mix (green cap) 0.5 µl
      10 µM Illumina P5 Primer 2.5 µl
      10 µM Illumina P7 Primer 2.5 µl
      Total 36.0 µl

NOTE: This protocol was developed using the SureSelectXT Human All Exon v5 Capture Library.

Related Products

Cat. # Product Size Price License Quantity Details
R400674 ThruPLEX® DNA-Seq Kit 24 Rxns USD $770.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index and unique dual index kits are available and must be purchased separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400674: ThruPLEX DNA-Seq Kit

R400674: ThruPLEX DNA-Seq Kit
R400675 ThruPLEX® DNA-Seq Kit 48 Rxns USD $1485.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index and unique dual index kits are available and must be purchased separately. This product contains reagents for 48 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400675: ThruPLEX DNA-Seq Kit

R400675: ThruPLEX DNA-Seq Kit
R400676 ThruPLEX® DNA-Seq Kit 96 Rxns USD $2702.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index and unique dual index kits are available and must be purchased separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400676: ThruPLEX DNA-Seq Kit

R400676: ThruPLEX DNA-Seq Kit
R400677 ThruPLEX® DNA-Seq Kit 480 Rxns USD $12010.00

License Statement

ID Number  
M54 This product is covered by the claims of U.S. Patent Nos. 7,704,713 and its foreign counterparts. 
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

The ThruPLEX DNA-Seq Kit builds on the innovative ThruPLEX chemistry to generate high-complexity DNA libraries from as little as 50 pg of DNA. Single index and unique dual index kits are available and must be purchased separately. This product is composed of five 96-reaction kits (Cat. No. R400676), 480 reactions total, of ThruPLEX DNA-Seq reagents.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400677: SMARTer ThruPLEX DNA-Seq Kit

R400677: SMARTer ThruPLEX DNA-Seq Kit
R400734 ThruPLEX® Tag-Seq FLEX 24 Rxns USD $1059.00

License Statement

ID Number  
384 This product is protected by U.S. Patents 7,803,550, 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
438 This Product is protected by one or more patents from the family comprising:US10155942, AU2013337280, CA2889862, People's Republic of China Patent: ZL201380069090.3, US10961529, DE602013026292.6, EP2914745, UK2914745, HK1089485, JP6454281 and any corresponding patents, divisionals, continuations, patent application and foreign filings sharing priority with the same family.
448 This product is sold under license from Becton Dickinson and Company and is covered by one or more of the following US Patent Nos. 8,835,358; 9,290,808; 9,290,809; 9,315,857; 9,708,659; 9,816,137; 9,845,502; 10,047,394; 10,059,991; 10,202,646; 10,392,661; 10,619,203; and pending U.S. patent applications 16/551,638 and 16/846,133.

ThruPLEX Tag-Seq FLEX uses a simple, three-step workflow to generate high-complexity DNA libraries with unique molecular tags from standard or challenging samples such as FFPE and cell-free DNA. Unique dual index (UDI) kits are available for purchase separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400734: ThruPLEX Tag-Seq HV Core Components

R400734: ThruPLEX Tag-Seq HV Core Components
R400735 ThruPLEX® Tag-Seq FLEX 96 Rxns USD $3740.00

License Statement

ID Number  
384 This product is protected by U.S. Patents 7,803,550, 8,399,199; 9,598,727, 10,196,686, 10,208,337, and 10,155,942 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.
438 This Product is protected by one or more patents from the family comprising:US10155942, AU2013337280, CA2889862, People's Republic of China Patent: ZL201380069090.3, US10961529, DE602013026292.6, EP2914745, UK2914745, HK1089485, JP6454281 and any corresponding patents, divisionals, continuations, patent application and foreign filings sharing priority with the same family.
448 This product is sold under license from Becton Dickinson and Company and is covered by one or more of the following US Patent Nos. 8,835,358; 9,290,808; 9,290,809; 9,315,857; 9,708,659; 9,816,137; 9,845,502; 10,047,394; 10,059,991; 10,202,646; 10,392,661; 10,619,203; and pending U.S. patent applications 16/551,638 and 16/846,133.

ThruPLEX Tag-Seq FLEX uses a simple, three-step workflow to generate high-complexity DNA libraries with unique molecular tags from standard or challenging samples such as FFPE and cell-free DNA. Unique dual index (UDI) kits are available for purchase separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400735: ThruPLEX Tag-Seq HV Core Components

R400735: ThruPLEX Tag-Seq HV Core Components
R400736 ThruPLEX® DNA-Seq FLEX 96 Rxns USD $2353.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

ThruPLEX DNA-Seq FLEX uses a simple, three-step workflow to generate high-complexity DNA libraries from standard or challenging samples such as FFPE and cell-free DNA. Unique dual index (UDI) kits are available for purchase separately. This product contains reagents for 96 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400736: ThruPLEX DNA-Seq HV Core Components

R400736: ThruPLEX DNA-Seq HV Core Components
R400737 ThruPLEX® DNA-Seq FLEX 24 Rxns USD $657.00

License Statement

ID Number  
326 This product is protected by U.S. Patents 7,803,550; 8,399,199; 8,728,737, 9,598,727, 10,196,686, 10,208,337, 11,072,823 and corresponding foreign patents. Additional patents are pending. For further license information, please contact a Takara Bio USA licensing representative by email at licensing@takarabio.com.

ThruPLEX DNA-Seq FLEX uses a simple, three-step workflow to generate high-complexity DNA libraries from standard or challenging samples such as FFPE and cell-free DNA. Unique dual index (UDI) kits are available for purchase separately. This product contains reagents for 24 reactions.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

R400737: ThruPLEX DNA-Seq HV Core Components

R400737: ThruPLEX DNA-Seq HV Core Components


User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

logo strip white

©2025 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Partnering & Licensing
  • Vector information
  • Vector document overview
  • Vector document finder
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial biology
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • Antibodies and ELISA
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Our history
  • In the news
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • Trademarks
  • License statements
  • Quality statement
  • HQ-grade reagents
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
  • Website FAQs

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop exceptional products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
Takara Bio
  • Home
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Next-generation sequencing
  • Real-time PCR
  • Stem cell research
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Nucleic acid purification
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • New products
  • Special offers
  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • Services & Support
  • OEM
  • Instrument services
  • Gene and cell therapy manufacturing
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • Partnering & Licensing
  • Vector information
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Spatial biology
  • Real-time PCR
  • Nucleic acid purification
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Stem cell research
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • APPLICATIONS
  • Molecular diagnostics
  • mRNA and protein therapeutics
  • Pathogen detection
  • Immunotherapy research
  • Cancer research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Infectious diseases
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • In the news
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • HQ-grade reagents
  • International Contacts by Region
  • Need help?
  • Website FAQs
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us