Targeted capture of ThruPLEX libraries with Agilent SureSelectQXT

Home › Learning centers › Next-generation sequencing › DNA-seq protocols › Targeted capture with Agilent SureSelectQXT

Next-generation sequencing

New products

Need help?

Contact Sales

User-generated protocol

Targeted capture of ThruPLEX libraries with Agilent SureSelectQXT

Introduction Materials required Protocol

Introduction

Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The module marked in red is not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with the ThruPLEX DNA-Seq Kit, ThruPLEX DNA-Seq FLEX, and ThruPLEX Tag-Seq FLEX.

Integration of SureSelect^QXT with ThruPLEX kits
Additional reagents	Primers	Required	Illumina P5 and P7 primers
	Blocking oligos	Required	IDT xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
	Agilent Herculase II Fusion DNA Polymerase	Required	Agilent Cat. # 600677, 600679 (with dNTPs)
Agilent SureSelect^QXTReagent Kit	SureSelect^QXT Library Prep Kit, ILM, Box #2	Not used	Replace with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, or a ThruPLEX DNA-Seq Kit
	SureSelect^QXT Target Enrichment Kit, ILM (Hyb module, Box #1)	Required	The following reagent is not used: SureSelect^QXT Stop Solution
	SureSelect^QXT Target Enrichment Kit, ILM (Hyb module, Box # 2)	Required	The following reagent is not used: SureSelect^QXT Primer Mix

Materials required

Reagents

ThruPLEX DNA-Seq Kit, ThruPLEX DNA-Seq FLEX, or ThruPLEX Tag-Seq FLEX for library preparation
Two blocking oligos (both required):
- xGen Universal Blocking Oligo - TS HT-i5 (Integrated DNA Technologies; IDT)
- xGen Universal Blocking Oligo - TS HT-i7 (IDT)
Primers (both required):
- Illumina P5 Primer: AATGATACGGCGACCACCGA
- Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
SureSelect^QXT reagents: Refer to the "Required Reagents" section of the Agilent SureSelect^QXT protocol.

NOTE: The following item may be required for the post-capture amplification step: Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)

Equipment

As specified in the "Required Equipment" section of the Agilent SureSelect^QXT protocol.

NOTE: When integrating ThruPLEX kits with the SureSelect^QXT library capture system, all components of the SureSelect^QXT Reagent Kit are used except the following:

SureSelect^QXT Buffer
SureSelect^QXT Enzyme Mix ILM
DMSO
SureSelect^QXT Read Primer 1
SureSelect^QXT Read Primer 2
SureSelect^QXT Index Read Primer
SureSelect^QXT P7 dual indexing primers
SureSelect^QXT P5 dual indexing primers
SureSelect^QXT Stop Solution
SureSelect^QXT Primer Mix

Contact Agilent to order a SureSelect^QXT Reagent Kit without the SureSelect^QXT Library Prep Kit ILM, Box 2.

Protocol

ThruPLEX library preparation

Prepare ThruPLEX libraries according to the ThruPLEX user manual for your kit.
Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.

CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.

ThruPLEX library capture

Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
Using a narrow gauge needle, poke hole(s) in the lid of each tube containing a ThruPLEX library to be used for capture.
Concentrate the ThruPLEX library using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <10 µl. Do not completely dry the mixture.
Bring the volume to 10 µl with nuclease-free water.
To each resuspended library add:
- 1 µl xGen Universal Blocking Oligo - TS HT-i5
- 1 µl xGen Universal Blocking Oligo - TS HT-i7

Follow procedures in the Agilent SureSelect^QXT Protocol starting at Chapter 3, Step 2 through the end of Chapter 4, Step 5 with the following modification:
At Chapter 4, Step 1. Amplify the Captured Libraries, modify the Post-Capture PCR Reaction Mix to the following:

Reagent	Volume per rxn
Nuclease-free water	10.5 µl
5x Herculase Rxn Buffer	10.0 µl
Herculase II Fusion DNA Polymerase	1.0 µl
100 mM dNTP Mix	0.5 µl
10 µM Illumina P5 Primer	2.5 µl
10 µM Illumina P7 Primer	2.5 µl
Total	27.0 µl

The ThruPLEX libraries are already indexed, so do not use the SureSelect^QXT indexing primers.

NOTE: This protocol was developed using the SureSelect^XT Human All Exon v5 Capture Library.

Related Products

Cat. #	Product	Size	Price	License	Quantity	Details

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols.

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.