Oligo design tool for Guide-it SNP screening assays

Each SNP detection assay performed using the Guide-it Knockin Screening Kit involves the application of oligos designed to detect a specific substitution at a specified genomic locus. To simplify the oligo design process, we have developed the software tool below. Input the sequences corresponding to two alleles you wish to screen (e.g., wild-type/unedited and SNP/edited versions of your genomic target sequence), and the tool will output displacement, flap-probe, wild-type control, and SNP control oligos for your assay.

NOTE: This tool designs oligo probes for the screening of single-base substitutions only, not for insertions.

To design oligos for the detection of multiple substitutions in the genomic target region, please refer to "Detecting multiple edits" in the user guide.
To design oligos for the detection of targeted insertions, please refer to the Guide-it Knockin Screening Kit User Manual.

Click here for design tool user guide »

Design tool guidelines:

Edited input sequences must include exactly one SNP.
Both unedited and edited input sequences must be the same length.
Input sequence lengths cannot exceed 1,000 bases.
Input sequences should consist of at least 35 bases on either side of the SNP site. For optimal probe design, we recommend including ≥50 bases on either side.

NOTE: Please be careful to avoid the inclusion of extra spaces when inputting sequences, as these will be interpreted as part of the input and will likely return an error message.

To design oligos to detect multiple substitutions in parallel, please refer to "Detecting multiple edits" in the user guide.

Example:

Sequence before editing: GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCAGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT
Sequence after editing: GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCCGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT

Gene editing resources

Product finder

Use this gene editing product finder to quickly locate kits for screening, delivery, and downstream assays.

CRISPR tools and information

What is CRISPR/Cas9? Need help designing the best guide RNAs? Learn all this and more.

Genome-wide library screening

Learn how to conduct a CRISPR/Cas9 guide RNA library phenotypic screen and view data demonstrating the use of our library.

CRISPR/Cas9 knockouts

Technotes and tools used to create or study CRISPR-Cas9-mediated gene knockouts (indels).

CRISPR/Cas9 knockins

Information, technotes and tools used to create or study gene knockouts by CRISPR/Cas9 and HDR.

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2026 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.