We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us

Clontech Takara Cellartis

Close

  • ‹ Back to Viral detection with qPCR
  • High-throughput detection of SARS-CoV-2
  • Takara Bio testimonials
  • Viral detection via qPCR
  • Direct viral detection via qPCR
Dr. Bharathan Video testimonial: PrimeDirect Probe mix enables fast, inexpensive COVID-19 testing
SARS-CoV-2 image Viral detection via qPCR
Home › Products › COVID-19 research › Viral detection with qPCR › Direct viral detection via qPCR

COVID-19 research

  • Viral detection with qPCR
    • Takara Bio testimonials
    • Viral detection via qPCR
    • Direct viral detection via qPCR
  • SARS-CoV-2 pseudovirus
    • Universal
    • D614G
    • B.1.351
    • Wuhan-Hu-1
  • Drug discovery
    • hiPSC-based viral infection models
    • ADME-Tox studies
    • Therapeutics research
  • Publications
Need help?
Contact Sales
Dr. Bharathan Video testimonial: PrimeDirect Probe mix enables fast, inexpensive COVID-19 testing
SARS-CoV-2 image Viral detection via qPCR

Direct viral detection via qPCR

Viral detection directly from biological samples—no RNA purification

NOTE: The products featured here are for Research Use Only. They are not for use in diagnostics procedures.

Detection of inactivated influenza A virus H1N1

PrimeDirect Probe RT-qPCR Mix may be used directly with many types of biological samples, without the need for RNA purification, saving valuable time and resources. We performed H1N1 detection directly on biological samples using PrimeDirect Probe RT-qPCR Mix, following the protocol shown below. Inactivated influenza A virus was spiked into mouth swab samples, nasal swab samples, and saliva samples at a concentration of 2 x 100–102 copies/µl.

RT-qPCR of biological samples using PrimeDirect Probe RT-qPCR Mix

Test materials Instructions
Mouth swab Soak the sampled mouth swab into 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction.
Nasal cavity swab Soak the sampled nasal swab in 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction.
Saliva Directly add 1 µl of supernatant to the reaction.
Reagent Volume
PrimeDirect Probe RT-qPCR Mix (2X) 12.5 µl
Forward Primer (10 µM) 0.5 µl
Reverse Primer (10 µM) 0.5 µl
qPCR probe (10 µM) 0.5 µl
Test sample 1 µl
Influenza A virus H1N1 (2 x 100–102 copies/µl) 1 µl
RNase Free H2O 9 µl
Total 25 µl

PrimeDirect Probe RT-qPCR Mix enabled the detection of viral RNA directly from biological samples. The detection sensitivity from nasal cavity swab samples and saliva samples was 20 copies, and the sensitivity from mouth swab samples was 2 copies.

Jump down to view protocol guidelines for SARS-CoV-2 detection.

Cat. # Product Size Price License Quantity Details
RR650A PrimeDirect™ Probe RT-qPCR Mix 200 Rxns USD $431.00

PrimeDirect Probe RT-qPCR Mix is designed for one-step, real-time RT-PCR via probe detection (5'-nuclease method). This product is supplied as a 2X premix to facilitate the easy preparation of reaction mixtures. It requires only the addition of your primer, probe, and sample, and the RT-qPCR can be performed by simply adding your sample directly to the reaction mixture without intervening nucleic acid purification steps. Because this product is highly resistant to various PCR inhibitors in blood and soil, it can be used to directly detect pathogens, including viruses and bacteria, in various biological specimens and to directly analyze gene expression in cells.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

RR650A: PrimeDirect Probe RT-qPCR Mix

RR650A: PrimeDirect Probe RT-qPCR Mix

Overview

Protocol guidelines for direct SARS-CoV-2 detection using RT-qPCR

PrimeDirect Probe RT-qPCR Mix has been successfully tested by Takara Bio's R&D team on influenza A virus H1N1 spiked into biological samples, but we have not yet tested it with SARS-CoV-2-positive patient samples. However, protocol guidelines for SARS-CoV-2 detection have been developed by other groups.

Lübke et al. described their simple SARS-CoV-2 detection protocol for respiratory samples using PrimeDirect Probe RT-qPCR Mix in a Journal of Clinical Virology paper titled, "Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials." Here is a summary of their protocol, which may require optimization by the user.


RNA-extraction-free SARS-CoV-2 detection protocol

This protocol, developed by Lübke et al., can be used as a guideline for SARS-CoV-2 detection. It has not been validated by our R&D team for SARS-CoV-2 detection from patient samples.

Sample collection

In order to maintain reaction sensitivity, do not freeze or store samples at 4°C for more than seven days. This protocol is applicable for all primary respiratory samples.

  1. Preincubate viscous samples with Remel Sputasol (Thermo Fisher Scientific).
  2. Heat inactivate 50 µl of sample at 99°C for 5 min.
  3. Centrifuge heated samples at 4,000 rpm for 5 min.
  4. Add 5 µl of supernatant to the following reaction mix.

Reaction mix

The reaction mix (without respiratory sample) can be prepared in bulk quantity, and aliquots of 20 µl can be frozen for up to one week before use.

Reagent Volume
PrimeDirect Probe RT-qPCR Mix (2X) 12.5 µl
Forward Primer Calculate based on table below
Reverse Primer Calculate based on table below
qPCR probe Calculate based on table below
Viral PBS sample 5 µl
RNase Free H2O Fill to 25 µl
Total 25 µl

Primer and probes for SARS-CoV-2 detection and an internal control by direct RT-qPCR

Name Target Sequence Final conc. in rxn
CoV-E-F E gene CTTTTTCTTGCTTTCGTGGTATTCT 400 nM
CoV-E-R E gene TACAAGACTCACGTTAACAATATTGCA 400 nM
CoV-E-Pr E gene FAM-CTAGCCATCCTTACTGCGCTTCGATTGTG-BHQ 200 nM
HBV‑Taq1 HBV‑SynQ* CAACCTCCAATCACTCACCAAC 200 nM
HBV‑Taq2 HBV‑SynQ* ATATGATAAAACGCGCAGACAC 200 nM
HBV‑IC HBV‑SynQ* Cy5-CTGCCGAGCTCTGACTA-BHQ 200 nM

*HBV-SynQ (internal control): a synthetic plasmid coding for an inactivated S antigen of hepatitis B.

Thermal cycler program

95°C 30 sec Enzyme activation step
60°C 5 min Reverse transcription
Number of cycles: 45
95°C 5 sec Denaturation
60°C 30 sec Annealing/extension

With this protocol, the authors found a very high SARS-CoV-2 detection rate of 95.8% for Ct values <35 by direct RT-qPCR and an overall detection rate of 81.3%. Due to the flexibility and speed of this protocol, any respiratory sample can be utilized for SARS-CoV-2 detection in under one hour.

More Information

Please see the product's Certificate of Analysis for information about storage conditions, product components, and technical specifications. Please see the Kit Components List to determine kit components. Certificates of Analysis and Kit Components Lists are located under the Documents tab.


Powered by Bioz See more details on Bioz
Powered by Bioz See more details on Bioz

User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Find more products for COVID-19 research

  • Viral RNA isolation
  • Processing respiratory samples
  • Processing water samples
  • Viral detection via qPCR
  • Direct viral detection via qPCR
  • Viral and host sequencing
  • Immune profiling
  • Vaccine development
  • CRISPR screening

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

logo strip white

©2025 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Partnering & Licensing
  • Vector information
  • Vector document overview
  • Vector document finder
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial omics
  • Trekker resources
  • Seeker resources
  • Webinars
  • Datasets request
  • Cloud analysis
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • Antibodies and ELISA
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Our history
  • In the news
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • Trademarks
  • License statements
  • Quality statement
  • HQ-grade reagents
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
  • Website FAQs

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop exceptional products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
Takara Bio
  • Home
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Next-generation sequencing
  • Real-time PCR
  • Stem cell research
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Nucleic acid purification
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • New products
  • Special offers
  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral RNA isolation
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Nucleic acid purification
  • Automated platforms
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • Services & Support
  • OEM
  • Instrument services
  • Gene and cell therapy manufacturing
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • Partnering & Licensing
  • Vector information
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Spatial omics
  • Real-time PCR
  • Nucleic acid purification
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Stem cell research
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial omics
  • Trekker resources
  • Seeker resources
  • Webinars
  • Datasets request
  • Cloud analysis
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • Nucleic acid purification
  • Nucleic acid extraction webinars
  • Product demonstration videos
  • Product finder
  • Plasmid kit selection guide
  • RNA purification kit finder
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • APPLICATIONS
  • Molecular diagnostics
  • mRNA and protein therapeutics
  • Pathogen detection
  • Immunotherapy research
  • Cancer research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Infectious diseases
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • In the news
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • HQ-grade reagents
  • International Contacts by Region
  • Need help?
  • Website FAQs
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Company benefits
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Need help?
  • Privacy request
Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us