Direct viral detection via qPCR
Viral detection directly from biological samples—no RNA purification
NOTE: The products featured here are for Research Use Only. They are not for use in diagnostics procedures.
Detection of inactivated influenza A virus H1N1
PrimeDirect Probe RT-qPCR Mix may be used directly with many types of biological samples, without the need for RNA purification, saving valuable time and resources. We performed H1N1 detection directly on biological samples using PrimeDirect Probe RT-qPCR Mix, following the protocol shown below. Inactivated influenza A virus was spiked into mouth swab samples, nasal swab samples, and saliva samples at a concentration of 2 x 100–102 copies/µl.
| Test materials | Instructions |
|---|---|
| Mouth swab | Soak the sampled mouth swab into 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction. |
| Nasal cavity swab | Soak the sampled nasal swab in 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction. |
| Saliva | Directly add 1 µl of supernatant to the reaction. |
| Reagent | Volume |
|---|---|
| PrimeDirect Probe RT-qPCR Mix (2X) | 12.5 µl |
| Forward Primer (10 µM) | 0.5 µl |
| Reverse Primer (10 µM) | 0.5 µl |
| qPCR probe (10 µM) | 0.5 µl |
| Test sample | 1 µl |
| Influenza A virus H1N1 (2 x 100–102 copies/µl) | 1 µl |
| RNase Free H2O | 9 µl |
| Total | 25 µl |
PrimeDirect Probe RT-qPCR Mix enabled the detection of viral RNA directly from biological samples. The detection sensitivity from nasal cavity swab samples and saliva samples was 20 copies, and the sensitivity from mouth swab samples was 2 copies.
Jump down to view protocol guidelines for SARS-CoV-2 detection.
Overview
Protocol guidelines for direct SARS-CoV-2 detection using RT-qPCR
PrimeDirect Probe RT-qPCR Mix has been successfully tested by Takara Bio's R&D team on influenza A virus H1N1 spiked into biological samples, but we have not yet tested it with SARS-CoV-2-positive patient samples. However, protocol guidelines for SARS-CoV-2 detection have been developed by other groups.
Lübke et al. described their simple SARS-CoV-2 detection protocol for respiratory samples using PrimeDirect Probe RT-qPCR Mix in a Journal of Clinical Virology paper titled, "Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials." Here is a summary of their protocol, which may require optimization by the user.
RNA-extraction-free SARS-CoV-2 detection protocol
This protocol, developed by Lübke et al., can be used as a guideline for SARS-CoV-2 detection. It has not been validated by our R&D team for SARS-CoV-2 detection from patient samples.
Sample collection
In order to maintain reaction sensitivity, do not freeze or store samples at 4°C for more than seven days. This protocol is applicable for all primary respiratory samples.
- Preincubate viscous samples with Remel Sputasol (Thermo Fisher Scientific).
- Heat inactivate 50 µl of sample at 99°C for 5 min.
- Centrifuge heated samples at 4,000 rpm for 5 min.
- Add 5 µl of supernatant to the following reaction mix.
Reaction mix
The reaction mix (without respiratory sample) can be prepared in bulk quantity, and aliquots of 20 µl can be frozen for up to one week before use.
| Reagent | Volume |
|---|---|
| PrimeDirect Probe RT-qPCR Mix (2X) | 12.5 µl |
| Forward Primer | Calculate based on table below |
| Reverse Primer | Calculate based on table below |
| qPCR probe | Calculate based on table below |
| Viral PBS sample | 5 µl |
| RNase Free H2O | Fill to 25 µl |
| Total | 25 µl |
Primer and probes for SARS-CoV-2 detection and an internal control by direct RT-qPCR
| Name | Target | Sequence | Final conc. in rxn |
| CoV-E-F | E gene | CTTTTTCTTGCTTTCGTGGTATTCT | 400 nM |
| CoV-E-R | E gene | TACAAGACTCACGTTAACAATATTGCA | 400 nM |
| CoV-E-Pr | E gene | FAM-CTAGCCATCCTTACTGCGCTTCGATTGTG-BHQ | 200 nM |
| HBV‑Taq1 | HBV‑SynQ* | CAACCTCCAATCACTCACCAAC | 200 nM |
| HBV‑Taq2 | HBV‑SynQ* | ATATGATAAAACGCGCAGACAC | 200 nM |
| HBV‑IC | HBV‑SynQ* | Cy5-CTGCCGAGCTCTGACTA-BHQ | 200 nM |
*HBV-SynQ (internal control): a synthetic plasmid coding for an inactivated S antigen of hepatitis B.
Thermal cycler program
| 95°C | 30 sec | Enzyme activation step | |||
| 60°C | 5 min | Reverse transcription | |||
| Number of cycles: 45 | |||||
| 95°C | 5 sec | Denaturation | |||
| 60°C | 30 sec | Annealing/extension | |||
With this protocol, the authors found a very high SARS-CoV-2 detection rate of 95.8% for Ct values <35 by direct RT-qPCR and an overall detection rate of 81.3%. Due to the flexibility and speed of this protocol, any respiratory sample can be utilized for SARS-CoV-2 detection in under one hour.
More Information
Please see the product's Certificate of Analysis for information about storage conditions, product components, and technical specifications. Please see the Kit Components List to determine kit components. Certificates of Analysis and Kit Components Lists are located under the Documents tab.
Powered by Bioz
User-generated protocols
User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols.
If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.
Questions? Protocols of your own that you would like to share?
Contact technical support Give feedbackTakara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2022 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.
