We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About

Close

  • ‹ Back to Viral detection with qPCR
  • Direct SARS-CoV-2 detection from saliva
  • Viral detection via qPCR
  • Direct viral detection via qPCR
  • High-throughput viral detection via qPCR
SARS-CoV-2 image Viral detection via qPCR
SmartChip system dispensing reagents High-throughput viral detection via qPCR
Wastewater Webinar: Resistomap tracks AR and SARS-CoV-2 in wastewater
Live webinar Live webinar: extraction-free SARS-CoV-2 detection in respiratory samples
Home › Products › COVID-19 research › Viral detection with qPCR › Direct viral detection via qPCR

COVID-19 research

  • Drug discovery
    • hiPSC-based viral infection models
    • ADME-Tox studies
    • Therapeutics research
  • Viral detection with qPCR
    • Direct SARS-CoV-2 detection from saliva
    • Viral detection via qPCR
    • Direct viral detection via qPCR
    • High-throughput viral detection via qPCR
  • Publications
Need help?
Contact Sales
SARS-CoV-2 image Viral detection via qPCR
SmartChip system dispensing reagents High-throughput viral detection via qPCR
Wastewater Webinar: Resistomap tracks AR and SARS-CoV-2 in wastewater
Live webinar Live webinar: extraction-free SARS-CoV-2 detection in respiratory samples

Direct viral detection via qPCR

Viral detection directly from biological samples—no RNA purification

NOTE: The products featured here are for Research Use Only. They are not for use in diagnostics procedures.

Detection of inactivated influenza A virus H1N1

PrimeDirect Probe RT-qPCR Mix may be used directly with many types of biological samples, without the need for RNA purification, saving valuable time and resources. We performed H1N1 detection directly on biological samples using PrimeDirect Probe RT-qPCR Mix, following the protocol shown below. Inactivated influenza A virus was spiked into mouth swab samples, nasal swab samples, and saliva samples at a concentration of 2 x 100–102 copies/µl.

RT-qPCR of biological samples using PrimeDirect Probe RT-qPCR Mix

Test materials Instructions
Mouth swab Soak the sampled mouth swab into 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction.
Nasal cavity swab Soak the sampled nasal swab in 200 µl PBS buffer, shake for 5 seconds, and then add 1 µl of supernatant to the reaction.
Saliva Directly add 1 µl of supernatant to the reaction.
Reagent Volume
PrimeDirect Probe RT-qPCR Mix (2X) 12.5 µl
Forward Primer (10 µM) 0.5 µl
Reverse Primer (10 µM) 0.5 µl
qPCR probe (10 µM) 0.5 µl
Test sample 1 µl
Influenza A virus H1N1 (2 x 100–102 copies/µl) 1 µl
RNase Free H2O 9 µl
Total 25 µl

PrimeDirect Probe RT-qPCR Mix enabled the detection of viral RNA directly from biological samples. The detection sensitivity from nasal cavity swab samples and saliva samples was 20 copies, and the sensitivity from mouth swab samples was 2 copies.

Jump down to view protocol guidelines for SARS-CoV-2 detection.

Cat. # Product Size Price License Quantity Details
RR650A PrimeDirect™ Probe RT-qPCR Mix 200 Rxns USD $340.00

PrimeDirect Probe RT-qPCR Mix is designed for one-step, real-time RT-PCR via probe detection (5'-nuclease method). This product is supplied as a 2X premix to facilitate the easy preparation of reaction mixtures. It requires only the addition of your primer, probe, and sample, and the RT-qPCR can be performed by simply adding your sample directly to the reaction mixture without intervening nucleic acid purification steps. Because this product is highly resistant to various PCR inhibitors in blood and soil, it can be used to directly detect pathogens, including viruses and bacteria, in various biological specimens and to directly analyze gene expression in cells.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Documents Components Image Data

Back

RR650A: PrimeDirect Probe RT-qPCR Mix

RR650A: PrimeDirect Probe RT-qPCR Mix
RR650B PrimeDirect™ Probe RT-qPCR Mix 1,000 Rxns USD $1226.00

PrimeDirect Probe RT-qPCR Mix is designed for one-step, real-time RT-PCR via probe detection (5'-nuclease method). This product is supplied as a 2X premix to facilitate the easy preparation of reaction mixtures. It requires only the addition of your primer, probe, and sample, and the RT-qPCR can be performed by simply adding your sample directly to the reaction mixture without intervening nucleic acid purification steps. Because this product is highly resistant to various PCR inhibitors in blood and soil, it can be used to directly detect pathogens, including viruses and bacteria, in various biological specimens and to directly analyze gene expression in cells.

RR650B consists of 5 units of RR650A. For associated product documentation, please see RR650A.

Notice to purchaser

Our products are to be used for Research Use Only. They may not be used for any other purpose, including, but not limited to, use in humans, therapeutic or diagnostic use, or commercial use of any kind. Our products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without our prior written approval.

Overview

Protocol guidelines for direct SARS-CoV-2 detection using RT-qPCR

PrimeDirect Probe RT-qPCR Mix has been successfully tested by Takara Bio's R&D team on influenza A virus H1N1 spiked into biological samples, but we have not yet tested it with SARS-CoV-2-positive patient samples. However, protocol guidelines for SARS-CoV-2 detection have been developed by other groups.

Lübke et al. described their simple SARS-CoV-2 detection protocol for respiratory samples using PrimeDirect Probe RT-qPCR Mix in a Journal of Clinical Virology paper titled, "Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials." Here is a summary of their protocol, which may require optimization by the user.


RNA-extraction-free SARS-CoV-2 detection protocol

This protocol, developed by Lübke et al., can be used as a guideline for SARS-CoV-2 detection. It has not been validated by our R&D team for SARS-CoV-2 detection from patient samples.

Sample collection

In order to maintain reaction sensitivity, do not freeze or store samples at 4°C for more than seven days. This protocol is applicable for all primary respiratory samples.

  1. Preincubate viscous samples with Remel Sputasol (Thermo Fisher Scientific).
  2. Heat inactivate 50 µl of sample at 99°C for 5 min.
  3. Centrifuge heated samples at 4,000 rpm for 5 min.
  4. Add 5 µl of supernatant to the following reaction mix.

Reaction mix

The reaction mix (without respiratory sample) can be prepared in bulk quantity, and aliquots of 20 µl can be frozen for up to one week before use.

Reagent Volume
PrimeDirect Probe RT-qPCR Mix (2X) 12.5 µl
Forward Primer Calculate based on table below
Reverse Primer Calculate based on table below
qPCR probe Calculate based on table below
Viral PBS sample 5 µl
RNase Free H2O Fill to 25 µl
Total 25 µl

Primer and probes for SARS-CoV-2 detection and an internal control by direct RT-qPCR

Name Target Sequence Final conc. in rxn
CoV-E-F E gene CTTTTTCTTGCTTTCGTGGTATTCT 400 nM
CoV-E-R E gene TACAAGACTCACGTTAACAATATTGCA 400 nM
CoV-E-Pr E gene FAM-CTAGCCATCCTTACTGCGCTTCGATTGTG-BHQ 200 nM
HBV‑Taq1 HBV‑SynQ* CAACCTCCAATCACTCACCAAC 200 nM
HBV‑Taq2 HBV‑SynQ* ATATGATAAAACGCGCAGACAC 200 nM
HBV‑IC HBV‑SynQ* Cy5-CTGCCGAGCTCTGACTA-BHQ 200 nM

*HBV-SynQ (internal control): a synthetic plasmid coding for an inactivated S antigen of hepatitis B.

Thermal cycler program

95°C 30 sec Enzyme activation step
60°C 5 min Reverse transcription
Number of cycles: 45
95°C 5 sec Denaturation
60°C 30 sec Annealing/extension

With this protocol, the authors found a very high SARS-CoV-2 detection rate of 95.8% for Ct values <35 by direct RT-qPCR and an overall detection rate of 81.3%. Due to the flexibility and speed of this protocol, any respiratory sample can be utilized for SARS-CoV-2 detection in under one hour.

More Information

Please see the product's Certificate of Analysis for information about storage conditions, product components, and technical specifications. Please see the Kit Components List to determine kit components. Certificates of Analysis and Kit Components Lists are located under the Documents tab.


User-generated protocols

User-generated protocols

User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols. 

If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.

Questions? Protocols of your own that you would like to share?

Contact technical support Give feedback

Find more products for COVID-19 research

  • Viral RNA isolation
  • Processing respiratory samples
  • Processing water samples
  • Viral detection via qPCR
  • Direct viral detection via qPCR
  • High-throughput viral detection via qPCR
  • Viral and host sequencing
  • Immune profiling
  • Vaccine development
  • CRISPR screening

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2020 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, TBUSA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Support
  • Contact us
  • Technical support
  • Customer service
  • Shipping & delivery
  • Sales
  • Feedback
Products
  • New products
  • Special offers
  • Instrument & reagent services
  • Corporate development
Learning centers
  • NGS
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
About
  • Our brands
  • Careers
  • Events
  • Blog
  • Need help?
  • Announcements
  • Quality and compliance
  • That's Good Science!
Facebook Twitter  LinkedIn

©2021 Takara Bio Inc. All Rights Reserved.

Region - North America Privacy Policy Terms and Conditions Terms of Use

Top



  • COVID-19 research
  • Drug discovery
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Viral RNA isolation
  • Immune profiling
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Publications
  • Automation systems
  • SmartChip Real-Time PCR System, chips, and reagents
  • Apollo system
  • ICELL8 system and software
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Whole genome amplification
  • Immune profiling
  • Bioinformatics tools
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • RNA extraction and analysis for real-time qPCR
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Human iPS cell gene editing systems
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • cDNA synthesis
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion Cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Cell biology assays
  • Extracellular vesicle isolation
  • Exosome isolation (cell culture)
  • Reporter systems
  • Apoptosis detection kits
  • Epigenetics
  • Signal transduction
  • Gene function
  • Gene editing
  • Fluorescent proteins
  • Viral transduction
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • Extracellular vesicle purification kit samples
  • GoStix Plus special offers
  • PCR samples
Vaccine development

Vaccine development

The rapid spread of severe infections by viruses such as SARS-CoV-2, HIV, H1N1, Ebola, and Zika has highlighted the critical need for the rapid development of vaccines against previously unknown pathogens to deal with pandemics such as COVID-19 effectively.

Takara Bio is proud to be on the front line in the fight to defeat the novel coronavirus by enabling innovative vaccine development. This section discusses tools and techniques to overcome the challenges faced during the vaccine development process.

Learn how our products help speed up vaccine development

  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • Apollo library prep system introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Product line overview
  • Technical notes
  • FAQs and tips
  • Bioinformatics resources
  • Newsletters
  • Webinars
  • Citations
  • Posters
  • Real-time PCR
  • Product finder
  • Reaction size guidelines for qPCR
  • Real-time PCR products brochure
  • Real-time PCR tutorial videos
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Overview
  • Technical notes
  • FAQs
  • Stem cell research
  • Protocols
  • Applications
  • Technical notes
  • Webinars
  • Videos
  • Citations
  • Nucleic acid purification
  • Product finder
  • Plasmid purification
  • Genomic DNA purification
  • DNA/RNA cleanup and extraction
  • Automated DNA and RNA purification
  • RNA purification
  • Hard-to-lyse samples
  • cDNA synthesis
  • PCR
  • Citations
  • Selection guides
  • PCR enzyme brochure
  • Technical notes
  • PCR FAQs
  • Cloning
  • In-Fusion Cloning: general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and tech notes
  • Cell biology assays
  • Extracellular vesicle isolation
  • Technical notes
  • FAQs
  • Citations
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Transfection reagents
  • Fluorescent proteins
  • Protein research
  • Capturem technology
  • Antibody purification
  • His-tag purification
  • Phosphoprotein and glycoprotein purification
  • Mass spectrometry digestion reagents
  • Matchmaker Gold yeast two-hybrid systems
  • Antibodies and ELISA
Capturem Trypsin for a rapid, efficient mass spectometry workflow at room temperature.

Speed up your mass spec workflow

Capturem Trypsin provides rapid, efficient, and complete digestion of protein samples, allowing an uninterrupted mass spectometry workflow at room temperature for downstream protein analysis. This product utilizes our novel Capturem technology in a spin column format with membrane-immobilized trypsin. Capturem Trypsin Columns may be used to completely digest protein samples in less than a minute with digestion efficiencies (protein coverage) comparable to or better than those obtained using in-solution trypsin digestion.

Capturem trypsin technology

  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • OEM & custom enzyme manufacturing
  • Services
  • Quality
  • Expertise
  • OEM enzyme FAQs
  • Custom enzyme samples
  • Exploring OEM and custom enzyme partnerships
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Make an appointment with your sales rep
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Corporate development
  • Partnering & OEM solutions
  • In licensing
  • Out licensing
  • Submit a licensing request
  • Webinars
  • NGS: biomarkers and oncology
  • NGS: immunology
  • Stem cells
  • Real-time PCR
  • Gene function
  • Protein science
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

Learn more

  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Our history
  • Announcements
  • Events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Trademarks
  • License statements
  • Quality statement
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Need help?
  • Website FAQs
Best-in-class products, expert support, superior value

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop best-in-class products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
  • Home
  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, TBUSA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Automation systems
  • Next-generation sequencing
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
  • Antibodies and ELISA
  • Cell biology assays
  • Real-time PCR
  • cDNA synthesis
  • COVID-19 research
  • Drug discovery
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Viral RNA isolation
  • Immune profiling
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Publications
  • Automation systems
  • SmartChip Real-Time PCR System, chips, and reagents
  • Apollo system
  • ICELL8 system and software
  • Next-generation sequencing
  • RNA-seq
  • DNA-seq
  • Whole genome amplification
  • Immune profiling
  • Epigenetics and small RNA sequencing
  • NGS accessories
  • Bioinformatics tools
  • Gene function
  • Gene editing
  • Fluorescent proteins
  • Viral transduction
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • ProteoTuner protein control systems
  • iDimerize inducible protein interaction systems
  • Transfection reagents
  • Mammalian expression plasmids
  • Stem cell research
  • Media and supplements
  • Stem cells and stem cell-derived cells
  • Human iPS cell gene editing systems
  • Accessories
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Expression vectors & systems
  • Glycobiology
  • Antibodies and immunoprecipitation
  • SDS-PAGE & western blotting
  • Protein sequencing
  • Accessory enzymes
  • PCR
  • Most popular polymerases
  • Standard PCR
  • High-yield PCR
  • High-fidelity PCR
  • Fast PCR
  • Long-range PCR
  • GC rich PCR
  • Direct PCR
  • PCR master mixes
  • Custom business friendly and automation-ready solutions
  • Molecular diagnostic products
  • GMP-grade products
  • Application-specific PCR
  • Other PCR-related products
  • PCR thermal cyclers
  • Cloning
  • In-Fusion Cloning
  • Competent cells
  • Ligation kits
  • Mutagenesis kits
  • Ligation enzymes
  • Restriction enzymes
  • Modifying enzymes
  • X-Gal and IPTG
  • Linkers, primers, and cloning vectors
  • Agarose gel electrophoresis
  • Nucleic acid extraction
  • Nucleic acid purification
  • Plasmid purification kits
  • Genomic DNA purification kits
  • DNA cleanup kits
  • RNA purification kits
  • RNA cleanup kits
  • Viral DNA and RNA purification kits
  • Accessories and components
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Secondary antibodies
  • Antibody and ELISA accessories
  • Fluorescent protein antibodies
  • Cell biology assays
  • Extracellular vesicle isolation
  • Exosome isolation (cell culture)
  • Reporter systems
  • Apoptosis detection kits
  • Epigenetics
  • Cell biology reagents
  • RNA interference
  • Cell-culture accessories
  • Signal transduction
  • Real-time PCR
  • Real-time PCR kits
  • Reverse transcription prior to qPCR
  • Real-time PCR primer sets
  • References and standards for qPCR
  • RNA extraction and analysis for real-time qPCR
  • Application-specific qPCR
  • cDNA synthesis
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • cDNA synthesis accessories
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Gene function
  • Stem cell research
  • Protein research
  • PCR
  • Cloning
  • Nucleic acid purification
  • Antibodies and ELISA
  • Cell biology assays
  • Real-time PCR
  • cDNA synthesis
  • Automation systems
  • SmartChip Real-Time PCR System introduction
  • Apollo library prep system introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • Product line overview
  • Technical notes
  • Featured kits
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Newsletters
  • Webinars
  • Citations
  • Posters
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Transfection reagents
  • Fluorescent proteins
  • Stem cell research
  • Protocols
  • Applications
  • Technical notes
  • Posters
  • Webinars
  • Videos
  • FAQs
  • Citations
  • Selection guides
  • Overview
  • Protein research
  • Capturem technology
  • Antibody purification
  • His-tag purification
  • Other tag purification
  • Phosphoprotein and glycoprotein purification
  • Mass spectrometry digestion reagents
  • Matchmaker Gold yeast two-hybrid systems
  • Expression systems
  • PCR
  • Citations
  • Selection guides
  • PCR enzyme brochure
  • Technical notes
  • PCR FAQs
  • Go green with lyophilized enzymes
  • LA PCR technology
  • Cloning
  • In-Fusion Cloning: general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and tech notes
  • Sign up to stay updated
  • Traditional molecular cloning
  • Nucleic acid purification
  • Product finder
  • Plasmid purification
  • Genomic DNA purification
  • DNA/RNA cleanup and extraction
  • Parallel DNA, RNA & protein
  • Automated DNA and RNA purification
  • RNA purification
  • Hard-to-lyse samples
  • Antibodies and ELISA
  • Osteocalcin focus
  • Cell biology assays
  • Extracellular vesicle isolation
  • Technical notes
  • FAQs
  • Citations
  • Real-time PCR
  • Product finder
  • Reaction size guidelines for qPCR
  • Real-time PCR products brochure
  • Real-time PCR tutorial videos
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Overview
  • Technical notes
  • FAQs
  • cDNA synthesis
  • Premium total and poly A+ RNA
  • SMARTer RACE 5'/3' Kit—advances in SMARTer PCR cDNA synthesis
  • Cloning antibody variable regions
  • Services & Support
  • Instrument services
  • OEM & custom enzyme manufacturing
  • Stem cell services
  • Gene and cell therapy manufacturing services
  • Customer service
  • Technical support
  • Sales
  • Shipping & delivery
  • Feedback
  • Corporate development
  • Webinars from Takara Bio
  • Vector information
  • Online tools
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip services
  • OEM & custom enzyme manufacturing
  • Services
  • Quality
  • Expertise
  • OEM enzyme FAQs
  • Custom enzyme samples
  • Exploring OEM and custom enzyme partnerships
  • Stem cell services
  • Clinical-grade stem cell services
  • Research-grade stem cell services
  • Outsourcing stem cell-based disease model development
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Sales
  • Make an appointment with your sales rep
  • Corporate development
  • Partnering & OEM solutions
  • In licensing
  • Out licensing
  • Submit a licensing request
  • Webinars from Takara Bio
  • NGS: biomarkers and oncology
  • NGS: immunology
  • Stem cells
  • Real-time PCR
  • Gene function
  • Protein science
  • Vector information
  • Vector document overview
  • Vector document finder
  • Online tools
  • GoStix Plus FAQs
  • Areas of interest
  • Pathogen detection
  • Vaccine development
  • Cancer research
  • Immunotherapy research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Vaccine development
  • Characterizing the viral genome and host response
  • Identifying and cloning vaccine targets
  • Expressing and purifying vaccine targets
  • Immunizing mice and optimizing vaccine targets
  • Cancer research
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker discovery
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Preimplantation genetic testing
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • Announcements
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • Takara Bio affiliates & distributors
  • Need help?
  • Website FAQs
  • DSS Takara Bio India Pvt. Ltd : Manufacturing
  • Our partners
  • Special offers
  • New products
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • Season one
  • Season two
  • Season three
  • Our brands
  • Takara
  • Clontech
  • Cellartis
  • Events
  • Calendar
  • Conferences
  • Speak with us
  • Takara Bio affiliates & distributors
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors, by country
  • Special offers
  • Extracellular vesicle purification kit samples
  • GoStix Plus special offers
  • PCR samples
  • End of Year Promo
  • Products
  • Learning centers
  • Services & Support
  • Areas of interest
  • About