We use cookies to improve your browsing experience and provide meaningful content. Read our cookie policy. Accept
  •  Customer Login
  • Register
  •  View Cart (0)
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us

Clontech Takara Cellartis

Close

  • ‹ Back to Creating and screening for SNPs
  • SNP detection with knockin screening kit
  • Oligo design tool for SNP screening
    • Oligo design tool user guide (SNPs)
  • Sign up: SNP engineering webinar
  • Guide-it SNP Screening Kit FAQs
Guide-it Knockin Screening Kit product page Guide-it Knockin Screening Kit product information
Home › Learning centers › Gene function › Gene editing › Creating and screening for SNPs › Oligo design tool for SNP screening

Creating and screening for SNPs

  • SNP detection with knockin screening kit
  • Oligo design tool for SNP screening
    • Oligo design tool user guide (SNPs)
  • Sign up: SNP engineering webinar
  • Guide-it SNP Screening Kit FAQs
New products
Contact Sales
Guide-it Knockin Screening Kit product page Guide-it Knockin Screening Kit product information

Oligo design tool for Guide-it SNP screening assays

Each SNP detection assay performed using the Guide-it Knockin Screening Kit involves the application of oligos designed to detect a specific substitution at a specified genomic locus. To simplify the oligo design process, we have developed the software tool below. Input the sequences corresponding to two alleles you wish to screen (e.g., wild-type/unedited and SNP/edited versions of your genomic target sequence), and the tool will output displacement, flap-probe, wild-type control, and SNP control oligos for your assay.

NOTE: This tool designs oligo probes for the screening of single-base substitutions only, not for insertions.

  • To design oligos for the detection of multiple substitutions in the genomic target region, please refer to "Detecting multiple edits" in the user guide.
  • To design oligos for the detection of targeted insertions, please refer to the Guide-it Knockin Screening Kit User Manual.

Click here for design tool user guide »

Design tool guidelines:

  • Edited input sequences must include exactly one SNP.
  • Both unedited and edited input sequences must be the same length.
  • Input sequence lengths cannot exceed 1,000 bases.
  • Input sequences should consist of at least 35 bases on either side of the SNP site. For optimal probe design, we recommend including ≥50 bases on either side.

NOTE: Please be careful to avoid the inclusion of extra spaces when inputting sequences, as these will be interpreted as part of the input and will likely return an error message.

To design oligos to detect multiple substitutions in parallel, please refer to "Detecting multiple edits" in the user guide.

Example:

Sequence before editing: GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCAGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT
Sequence after editing:   GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCCGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT


Gene editing resources

Product finder

Use this gene editing product finder to quickly locate kits for screening, delivery, and downstream assays.

CRISPR tools and information

What is CRISPR/Cas9? Need help designing the best guide RNAs? Learn all this and more.

Genome-wide library screening

Learn how to conduct a CRISPR/Cas9 guide RNA library phenotypic screen and view data demonstrating the use of our library.

CRISPR/Cas9 knockouts

Technotes and tools used to create or study CRISPR-Cas9-mediated gene knockouts (indels).

CRISPR/Cas9 knockins

Information, technotes and tools used to create or study gene knockouts by CRISPR/Cas9 and HDR.

Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

Takara Bio Europe

Takara Bio Europe is a member of the Takara Bio Group, a leading life sciences company that is committed to improving the human condition through biotechnology. Through our Takara, Clontech, and Cellartis brands, our mission is to develop high-quality innovative tools and services to accelerate discovery.

ordersEU@takarabio.com
techEU@takarabio.com
+33 139 046 880

Takara Bio affiliates & distributors
  • Europe
  • China
  • India
  • Japan
  • Korea
  • United States and Canada
  • Affiliates & distributors, by country
Our brands
Support
  • Technical support
  • Careers
  • Shipping information
Facebook Twitter  LinkedIn

©2025 Takara Bio Inc. All Rights Reserved.

Region - Euro A Privacy Policy Terms and conditions Terms of Use Cookie Management

Top



  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISAs
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • New products
  • Special offers
  • Lab Essentials
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing services
  • Services
  • Facilities
  • Our process
  • Resources
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • GoStix Plus FAQs
  • Partnering & Licensing
  • Vector information
  • Vector document overview
  • Vector document finder
Takara Bio's award-winning GMP-compliant manufacturing facility in Kusatsu, Shiga, Japan.

Partner with Takara Bio!

Takara Bio is proud to offer GMP-grade manufacturing capabilities at our award-winning facility in Kusatsu, Shiga, Japan.

  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Spatial biology
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • Antibodies and ELISA
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
Create a web account with us

Log in to enjoy additional benefits

Want to save this information?

An account with takarabio.com entitles you to extra features such as:

•  Creating and saving shopping carts
•  Keeping a list of your products of interest
•  Saving all of your favorite pages on the site*
•  Accessing restricted content

*Save favorites by clicking the star () in the top right corner of each page while you're logged in.

Create an account to get started

  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Our brands
  • Our history
  • In the news
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • Careers
  • Trademarks
  • License statements
  • Quality statement
  • HQ-grade reagents
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
  • Website FAQs

That's GOOD Science!

What does it take to generate good science? Careful planning, dedicated researchers, and the right tools. At Takara Bio, we thoughtfully develop exceptional products to tackle your most challenging research problems, and have an expert team of technical support professionals to help you along the way, all at superior value.

Explore what makes good science possible

 Customer Login
 View Cart (0)
Takara Bio
  • Home
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us
  •  Customer Login
  • Register
  •  View Cart (0)

Takara Bio USA, Inc. provides kits, reagents, instruments, and services that help researchers explore questions about gene discovery, regulation, and function. As a member of the Takara Bio Group, Takara Bio USA is part of a company that holds a leadership position in the global market and is committed to improving the human condition through biotechnology. Our mission is to develop high-quality innovative tools and services to accelerate discovery.

FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES (EXCEPT AS SPECIFICALLY NOTED).

Clontech, TaKaRa, cellartis

  • Products
  • COVID-19 research
  • Next-generation sequencing
  • Real-time PCR
  • Stem cell research
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • New products
  • Special offers
  • COVID-19 research
  • Viral detection with qPCR
  • SARS-CoV-2 pseudovirus
  • Human ACE2 stable cell line
  • Viral and host sequencing
  • Vaccine development
  • CRISPR screening
  • Drug discovery
  • Immune profiling
  • Publications
  • Next-generation sequencing
  • Spatial omics
  • RNA-seq
  • DNA-seq
  • Single-cell NGS automation
  • Reproductive health
  • Bioinformatics tools
  • Immune profiling
  • Real-time PCR
  • Great value master mixes
  • Signature enzymes
  • High-throughput real-time PCR solutions
  • Detection assays
  • References, standards, and buffers
  • Stem cell research
  • Media, differentiation kits, and matrices
  • Stem cells and stem cell-derived cells
  • mRNA and cDNA synthesis
  • In vitro transcription
  • cDNA synthesis kits
  • Reverse transcriptases
  • RACE kits
  • Purified cDNA & genomic DNA
  • Purified total RNA and mRNA
  • PCR
  • Most popular polymerases
  • High-yield PCR
  • High-fidelity PCR
  • GC rich PCR
  • PCR master mixes
  • Cloning
  • In-Fusion seamless cloning
  • Competent cells
  • Ligation kits
  • Restriction enzymes
  • Gene function
  • Gene editing
  • Viral transduction
  • Fluorescent proteins
  • T-cell transduction and culture
  • Tet-inducible expression systems
  • Transfection reagents
  • Cell biology assays
  • Protein research
  • Purification products
  • Two-hybrid and one-hybrid systems
  • Mass spectrometry reagents
  • Antibodies and ELISA
  • Primary antibodies and ELISAs by research area
  • Fluorescent protein antibodies
  • Special offers
  • Lab Essentials
  • Services & Support
  • OEM
  • Instrument services
  • Gene and cell therapy manufacturing
  • Customer service
  • Sales
  • Shipping & delivery
  • Technical support
  • Feedback
  • Online tools
  • Partnering & Licensing
  • Vector information
  • OEM
  • Portfolio
  • Process
  • Facilities
  • Request samples
  • FAQs
  • Instrument services
  • Apollo services
  • ICELL8 services
  • SmartChip ND system services
  • Gene and cell therapy manufacturing
  • Services
  • Facilities
  • Our process
  • Resources
  • Online tools
  • GoStix Plus FAQs
  • Vector information
  • Vector document overview
  • Vector document finder
  • Learning centers
  • Automation systems
  • Next-generation sequencing
  • Spatial biology
  • Real-time PCR
  • mRNA and cDNA synthesis
  • PCR
  • Cloning
  • Stem cell research
  • Gene function
  • Protein research
  • Antibodies and ELISA
  • Automation systems
  • Shasta Single Cell System introduction
  • SmartChip Real-Time PCR System introduction
  • ICELL8 introduction
  • Next-generation sequencing
  • RNA-seq
  • Technical notes
  • Technology and application overviews
  • FAQs and tips
  • DNA-seq protocols
  • Bioinformatics resources
  • Webinars
  • Real-time PCR
  • Download qPCR resources
  • Overview
  • Reaction size guidelines
  • Guest webinar: extraction-free SARS-CoV-2 detection
  • Technical notes
  • mRNA and cDNA synthesis
  • mRNA synthesis
  • cDNA synthesis
  • PCR
  • Citations
  • PCR selection guide
  • Technical notes
  • FAQ
  • Cloning
  • Automated In-Fusion Cloning
  • In-Fusion Cloning general information
  • Primer design and other tools
  • In‑Fusion Cloning tips and FAQs
  • Applications and technical notes
  • Stem cell research
  • Overview
  • Protocols
  • Technical notes
  • Gene function
  • Gene editing
  • Viral transduction
  • T-cell transduction and culture
  • Inducible systems
  • Cell biology assays
  • Protein research
  • Capturem technology
  • Antibody immunoprecipitation
  • His-tag purification
  • Other tag purification
  • Expression systems
  • APPLICATIONS
  • Molecular diagnostics
  • mRNA and protein therapeutics
  • Pathogen detection
  • Immunotherapy research
  • Cancer research
  • Alzheimer's disease research
  • Reproductive health technologies
  • Infectious diseases
  • Molecular diagnostics
  • Interview: adapting to change with Takara Bio
  • Applications
  • Solutions
  • Partnering
  • Contact us
  • mRNA and protein therapeutics
  • Characterizing the viral genome and host response
  • Identifying and cloning protein targets
  • Expressing and purifying protein targets
  • Immunizing mice and optimizing vaccines
  • Pathogen detection
  • Sample prep
  • Detection methods
  • Identification and characterization
  • SARS-CoV-2
  • Antibiotic-resistant bacteria
  • Food crop pathogens
  • Waterborne disease outbreaks
  • Viral-induced cancer
  • Immunotherapy research
  • T-cell therapy
  • Antibody therapeutics
  • T-cell receptor profiling
  • TBI initiatives in cancer therapy
  • Cancer research
  • Kickstart your cancer research with long-read sequencing
  • Sample prep from FFPE tissue
  • Sample prep from plasma
  • Cancer biomarker quantification
  • Single cancer cell analysis
  • Cancer transcriptome analysis
  • Cancer genomics and epigenomics
  • HLA typing in cancer
  • Gene editing for cancer therapy/drug discovery
  • Alzheimer's disease research
  • Antibody engineering
  • Sample prep from FFPE tissue
  • Single-cell sequencing
  • Reproductive health technologies
  • Embgenix FAQs
  • Preimplantation genetic testing
  • ESM partnership program
  • ESM Collection Kit forms
  • Infectious diseases
  • Develop vaccines for HIV
  • About
  • BioView blog
  • That's Good Science!
  • Our brands
  • Our history
  • In the news
  • Events
  • Careers
  • Trademarks
  • License statements
  • Quality and compliance
  • HQ-grade reagents
  • International Contacts by Region
  • Website FAQs
  • BioView blog
  • Automation
  • Cancer research
  • Career spotlights
  • Current events
  • Customer stories
  • Gene editing
  • Research news
  • Single-cell analysis
  • Stem cell research
  • Tips and troubleshooting
  • Women in STEM
  • That's Good Support!
  • About our blog
  • That's Good Science!
  • SMART-Seq Pro Biomarker Discovery Contest
  • DNA extraction educational activity
  • That's Good Science Podcast
  • Season one
  • Season two
  • Season three
  • Events
  • Biomarker discovery events
  • Calendar
  • Conferences
  • Speak with us
  • International Contacts by Region
  • United States and Canada
  • China
  • Japan
  • Korea
  • Europe
  • India
  • Affiliates & distributors
Takara Bio
  • Products
  • Services & Support
  • Learning centers
  • APPLICATIONS
  • About
  • Contact Us