PrimeSTAR LongSeq DNA Polymerase has extremely high specificity, making it possible to amplify ultra-long chains of over 50 kb and amplify difficult sequences such as long GC/AT-rich sequences. This high specificity requires primers have a melting temperature (Tm value) of 70°C or higher, greater than what most general PCR enzymes require. To increase the Tm value of primers, we recommend extending the 5' end of the primer to increase its length, therefore ensuring sufficient amplification.
Tech Note
PrimeSTAR LongSeq DNA Polymerase primer design
- Use primers with a melting temperature (Tm) of 70°C or higher when working with high-specificity PrimeSTAR LongSeq DNA Polymerase
- Extend the 5' end of the primer to increase the Tm of both forward and reverse primers
- Use a 3-step PCR protocol for primers with a Tm lower than 70°C (but higher than 62°C)
- Verify primer Tm recommendations through amplification of a 24 kb region of the β-globin gene with primers of varying Tms and with both 2-step and 3-step PCR protocols
Introduction
Recommendations
- Use ~35-mer primers with a Tm value >70°C, preferably with a Tm of 74°C or higher
- If the Tm value is below 70℃:
- Use a 3-step PCR protocol that allows for use of an annealing temperature that differs from the recommended 68°C extension temperature
- Lower the annealing temperature by 5℃ or more below the Tm value
- Match the Tm values of primers in multiplex PCR
- Use of a phosphothioate-modified base at the 3' end may improve amplification
Verification
To demonstrate successful amplification using the above primer design specifications with PrimeSTAR LongSeq DNA Polymerase, we designed primers of varying lengths, ranging from 15–34 bp in length (Table 1), to amplify a 24 kb region of the β-globin gene.
| Forward primer | Reverse primer | |||||
|---|---|---|---|---|---|---|
| Primer set | Sequence | Length (mer) | Tm (°C) | Sequence | Length (mer) | Tm (°C) |
| 1 | TACTGGTTGCCGATT | 15 | 48 | GCTTAGGAGTTGGACT | 16 | 44 |
| 2 | GCTACTGGTTGCCGATT | 17 | 55 | GGCTTAGGAGTTGGACT | 17 | 50 |
| 3 | GGGCTACTGGTTGCCGATT | 19 | 62 | GCACTGGCTTAGGAGTTGGACT | 22 | 62 |
| 4 | GCAAGGGCTACTGGTTGCCGATT | 23 | 69 | TGGCACTGGCTTAGGAGTTGGACT | 24 | 67 |
| 5 | AGTAGACGCAAGGGCTACTGGTTGCCGATT | 30 | 74 | CTCTTCTGGCACTGGCTTAGGAGTTGGACT | 30 | 72 |
| 6 | GCAGAGTAGACGCAAGGGCTACTGGTTGCCGATT | 34 | 78 | TTGGCTCTTCTGGCACTGGCTTAGGAGTTGGACT | 34 | 77 |
Table 1. Primer sequences used to amplify a region of the β-globin gene, with their corresponding Tm values. The red base pairs represent bases added to the primer from the original 15-mer primers.
PCR reactions were set up according to the PrimeSTAR LongSeq DNA Polymerase Data Sheet, using 100 ng of human genomic DNA as the input template. A Clontech PCR Thermal Cycler GP (Cat. # WN400) was used for either 2-step or 3-step PCR cycling conditions, with annealing temperatures of 68°C and 57°C, respectively (Figure 1). A 3-step PCR protocol was used to demonstrate the effect of changing the annealing temperature on successful amplification.

Figure 1. PCR cycling conditions for 2-step PCR and 3-step PCR. The 3-step PCR protocol allows for different annealing and extension temperatures.
Following the PCR reaction, products were run on an E-Gel. A 1 kb Plus DNA ladder was used to mark sizes on the E-gel.
Results
For 2-step PCR cycling conditions, specific amplification of a 24 kb long chain was confirmed when the annealing temperature was set to 68°C and primers with a Tm value of 69°C or higher were used (Figure 2, Panels A and C). Amplification was not observed for primers with a Tm value of 62°C or lower because the annealing temperature of 68°C used in the 2-step protocol is not 5°C below the primer Tm value.
For the 3-step PCR cycling conditions, specific amplification of a 24 kb long chain was confirmed when the annealing temperature was set to 57°C and primers with a Tm value of 62°C or higher were used. A 24 kb long chain amplification was not confirmed with primers having a Tm of 56°C (Figure 2, Panels B and C).

Figure 2. Results of amplification of human β-globin PCR with primers of varying Tm. Lanes are labeled with the primer set number assigned in Table 1. Lanes labeled M in Panels A and B contain a DNA ladder. Panel A. Using the 2-step PCR settings outlined in Figure 1, bands are visible, indicating sufficient amplification occurred, when the primers' Tm was 69°C or higher. Panel B. Using the 3-step PCR settings outlined in Figure 1, bands are visible, indicating sufficient amplification occurred, when the primers' Tm was 62°C or higher. Panel C. A comparison of PCR yield with forward primers’ Tm ranging from 48–78°C, using both 2- and 3-step PCR.
Conclusion
Due to the high specificity of PrimeSTAR LongSeq DNA Polymerase, we recommend primers with a Tm value of 70°C or higher to ensure sufficient amplification of your target sequence. The Tm value of primers can be increased by extending the 5' end of the primer to increase its length. If the Tm value of primers is lower than 70°C, a 3-step PCR protocol may be used. Designing primers with a Tm value of at least 70°C will ensure sufficient amplification of your ultra-long, GC/AT-rich sequences.
Takara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2026 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.

